Incidental Mutation 'R6667:Ighv6-4'
ID 527034
Institutional Source Beutler Lab
Gene Symbol Ighv6-4
Ensembl Gene ENSMUSG00000094174
Gene Name immunoglobulin heavy variable V6-4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 114406474-114406961 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114406532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000141798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177949] [ENSMUST00000191918]
AlphaFold J3QNN6
Predicted Effect probably benign
Transcript: ENSMUST00000177949
AA Change: V81A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136881
Gene: ENSMUSG00000094174
AA Change: V81A

DomainStartEndE-ValueType
IGv 17 99 9.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191918
AA Change: V100A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141798
Gene: ENSMUSG00000094174
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 119 3.3e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Ighv6-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03007:Ighv6-4 APN 12 114406593 missense possibly damaging 0.56
R0335:Ighv6-4 UTSW 12 114406674 missense probably benign 0.09
R0547:Ighv6-4 UTSW 12 114406601 missense probably damaging 1.00
R1225:Ighv6-4 UTSW 12 114406550 missense probably damaging 1.00
R1871:Ighv6-4 UTSW 12 114406601 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACAGTAGCTCCAGTCTCTAGG -3'
(R):5'- GTGAACCTGGAAGTGTCTGG -3'

Sequencing Primer
(F):5'- AGTAGCTCCAGTCTCTAGGTTACATG -3'
(R):5'- GCTTAGTTAAACCTGGAGGATCC -3'
Posted On 2018-07-23