Incidental Mutation 'R6667:Nol12'
ID 527040
Institutional Source Beutler Lab
Gene Symbol Nol12
Ensembl Gene ENSMUSG00000033099
Gene Name nucleolar protein 12
Synonyms C78541, Nop25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78934933-78943638 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78940080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 133 (D133E)
Ref Sequence ENSEMBL: ENSMUSP00000116103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123013] [ENSMUST00000138880] [ENSMUST00000145157] [ENSMUST00000149580]
AlphaFold Q8BG17
Predicted Effect unknown
Transcript: ENSMUST00000041164
AA Change: W84R
SMART Domains Protein: ENSMUSP00000042908
Gene: ENSMUSG00000033099
AA Change: W84R

DomainStartEndE-ValueType
Pfam:Nop25 4 170 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123013
SMART Domains Protein: ENSMUSP00000121877
Gene: ENSMUSG00000033099

DomainStartEndE-ValueType
Pfam:Nop25 45 83 5.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138880
AA Change: D133E

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116103
Gene: ENSMUSG00000033099
AA Change: D133E

DomainStartEndE-ValueType
Pfam:Nop25 5 156 9.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145157
Predicted Effect probably benign
Transcript: ENSMUST00000149580
SMART Domains Protein: ENSMUSP00000115374
Gene: ENSMUSG00000033099

DomainStartEndE-ValueType
Pfam:Nop25 4 140 7.1e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Nol12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Nol12 APN 15 78937174 missense probably damaging 1.00
IGL02690:Nol12 APN 15 78937174 missense probably damaging 1.00
IGL02972:Nol12 APN 15 78940599 missense probably damaging 1.00
R1434:Nol12 UTSW 15 78937953 splice site probably benign
R1836:Nol12 UTSW 15 78937889 missense probably damaging 1.00
R2484:Nol12 UTSW 15 78940517 intron probably benign
R4302:Nol12 UTSW 15 78940141 missense probably damaging 1.00
R5820:Nol12 UTSW 15 78940480 missense probably benign 0.08
R6339:Nol12 UTSW 15 78940833 unclassified probably benign
R7727:Nol12 UTSW 15 78940593 nonsense probably null
R8004:Nol12 UTSW 15 78940517 missense probably damaging 0.99
R8389:Nol12 UTSW 15 78935068 missense probably damaging 1.00
R9006:Nol12 UTSW 15 78940091 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTCATTCTGGTTCTCACACAG -3'
(R):5'- TTGGAAGCTGCAACAAGCTC -3'

Sequencing Primer
(F):5'- ATGGAGAAGTCCTGCTTGCTCAC -3'
(R):5'- ACATGTCACACTCGGCCTG -3'
Posted On 2018-07-23