Incidental Mutation 'R6667:Zfp943'
ID 527043
Institutional Source Beutler Lab
Gene Symbol Zfp943
Ensembl Gene ENSMUSG00000053347
Gene Name zinc finger prtoein 943
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21962552-22071168 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21992908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 325 (C325Y)
Ref Sequence ENSEMBL: ENSMUSP00000059554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055349] [ENSMUST00000153985] [ENSMUST00000174015]
AlphaFold Q6NZP4
Predicted Effect probably damaging
Transcript: ENSMUST00000055349
AA Change: C325Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059554
Gene: ENSMUSG00000053347
AA Change: C325Y

DomainStartEndE-ValueType
KRAB 13 72 2.62e-18 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 236 258 1.13e-4 SMART
ZnF_C2H2 264 286 1.03e-2 SMART
ZnF_C2H2 292 314 2.24e-3 SMART
ZnF_C2H2 320 342 9.58e-3 SMART
ZnF_C2H2 348 370 5.67e-5 SMART
ZnF_C2H2 376 398 4.54e-4 SMART
ZnF_C2H2 404 426 2.15e-5 SMART
ZnF_C2H2 432 454 5.59e-4 SMART
ZnF_C2H2 460 482 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153985
SMART Domains Protein: ENSMUSP00000115817
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 73 3.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174015
SMART Domains Protein: ENSMUSP00000133735
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 60 3.79e-15 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Other mutations in Zfp943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03101:Zfp943 APN 17 21992175 missense probably damaging 1.00
R0019:Zfp943 UTSW 17 21992089 intron probably benign
R0827:Zfp943 UTSW 17 21992090 critical splice acceptor site probably null
R1824:Zfp943 UTSW 17 21992380 missense probably benign 0.32
R1958:Zfp943 UTSW 17 21992998 missense probably damaging 0.99
R2174:Zfp943 UTSW 17 21992823 missense probably damaging 1.00
R3790:Zfp943 UTSW 17 21992422 missense possibly damaging 0.81
R4093:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4094:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4352:Zfp943 UTSW 17 21993123 missense probably damaging 0.98
R4677:Zfp943 UTSW 17 21993195 missense probably benign 0.17
R4735:Zfp943 UTSW 17 21992410 missense probably benign 0.03
R5201:Zfp943 UTSW 17 21992813 missense probably damaging 1.00
R5492:Zfp943 UTSW 17 21993075 missense probably damaging 1.00
R5642:Zfp943 UTSW 17 21992832 missense probably damaging 1.00
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6864:Zfp943 UTSW 17 21992612 missense probably damaging 1.00
R6976:Zfp943 UTSW 17 21990941 missense possibly damaging 0.47
R7837:Zfp943 UTSW 17 21992365 missense probably benign 0.39
R7934:Zfp943 UTSW 17 21993380 missense probably damaging 0.97
R8302:Zfp943 UTSW 17 21992110 missense probably benign 0.18
R8323:Zfp943 UTSW 17 21992782 missense possibly damaging 0.95
R9025:Zfp943 UTSW 17 21992340 missense possibly damaging 0.67
R9101:Zfp943 UTSW 17 21993411 missense possibly damaging 0.83
R9279:Zfp943 UTSW 17 21990851 missense possibly damaging 0.89
R9640:Zfp943 UTSW 17 21990918 missense probably damaging 0.99
Z1176:Zfp943 UTSW 17 21992965 missense probably damaging 1.00
Z1177:Zfp943 UTSW 17 21988082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTGGTCTTAGAAGTCATCAAAG -3'
(R):5'- AAGCTCACTTTTCAGGGCAAA -3'

Sequencing Primer
(F):5'- TCATCAAAGAATTCATACAGGAGGG -3'
(R):5'- CTAAGGTCGCCTTTCTGAGTGAAAC -3'
Posted On 2018-07-23