Incidental Mutation 'R6667:Alpk2'
ID 527045
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Name alpha-kinase 2
Synonyms Hak
MMRRC Submission 044787-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 65398600-65526959 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65440811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 661 (E661G)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
AlphaFold Q91ZB0
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: E661G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: E661G

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141250
AA Change: E194G

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: E194G

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,504,435 (GRCm39) A39E probably damaging Het
Agtr1b T A 3: 20,369,913 (GRCm39) N231I possibly damaging Het
Ankrd26 C T 6: 118,484,749 (GRCm39) S1496N probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atp12a T C 14: 56,621,645 (GRCm39) V760A possibly damaging Het
Casp2 T C 6: 42,256,770 (GRCm39) C343R probably damaging Het
Cblb T A 16: 51,973,007 (GRCm39) M446K possibly damaging Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Ddit4l A G 3: 137,331,882 (GRCm39) K83E probably benign Het
Eif1ad10 A T 12: 88,216,475 (GRCm39) D132E unknown Het
Epc2 A G 2: 49,412,681 (GRCm39) T220A probably damaging Het
Epha5 T C 5: 84,219,050 (GRCm39) D741G probably damaging Het
Flg2 A T 3: 93,109,068 (GRCm39) R365S possibly damaging Het
Ggn A T 7: 28,872,093 (GRCm39) H491L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Ighv6-4 A G 12: 114,370,152 (GRCm39) V100A probably benign Het
Invs A T 4: 48,402,870 (GRCm39) Y501F possibly damaging Het
Iqcm G T 8: 76,479,980 (GRCm39) G313W probably damaging Het
Jph2 A G 2: 163,218,206 (GRCm39) S157P probably damaging Het
Mast4 T C 13: 102,874,004 (GRCm39) E1596G probably damaging Het
Mllt6 T A 11: 97,567,760 (GRCm39) L759Q probably damaging Het
Nalcn A G 14: 123,558,735 (GRCm39) L837P probably damaging Het
Neb G A 2: 52,037,201 (GRCm39) T6836I probably damaging Het
Nol12 T A 15: 78,824,280 (GRCm39) D133E probably benign Het
Or5w13 A G 2: 87,523,914 (GRCm39) V104A probably benign Het
Oxtr C A 6: 112,454,060 (GRCm39) probably benign Het
Pcmt1 A G 10: 7,538,913 (GRCm39) L38P probably damaging Het
Pik3r2 T C 8: 71,221,817 (GRCm39) Y617C probably damaging Het
Potefam3b T C 8: 21,161,955 (GRCm39) S267P probably benign Het
Prl7a2 T C 13: 27,845,024 (GRCm39) N121D probably benign Het
Pvr G T 7: 19,639,727 (GRCm39) Q380K probably benign Het
Rtn2 A G 7: 19,021,184 (GRCm39) E188G probably benign Het
Setd4 C A 16: 93,386,918 (GRCm39) R260L probably benign Het
Six5 A G 7: 18,830,494 (GRCm39) N374D probably benign Het
Slc9b1 T C 3: 135,077,726 (GRCm39) I140T probably damaging Het
Supt16 A G 14: 52,409,520 (GRCm39) F797L probably damaging Het
Tbata T C 10: 61,021,142 (GRCm39) L262P probably damaging Het
Tti1 A T 2: 157,850,347 (GRCm39) C297* probably null Het
Ush1c C A 7: 45,875,048 (GRCm39) G139C probably damaging Het
Vmn1r1 C T 1: 181,985,342 (GRCm39) V108I probably benign Het
Vmn2r116 C T 17: 23,620,066 (GRCm39) T600I probably damaging Het
Zfp764l1 A G 7: 126,992,595 (GRCm39) M5T probably benign Het
Zfp873 A G 10: 81,896,423 (GRCm39) T422A probably benign Het
Zfp943 G A 17: 22,211,889 (GRCm39) C325Y probably damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65,438,894 (GRCm39) missense probably benign 0.27
IGL00478:Alpk2 APN 18 65,440,297 (GRCm39) nonsense probably null
IGL00898:Alpk2 APN 18 65,483,644 (GRCm39) missense probably benign 0.29
IGL00978:Alpk2 APN 18 65,424,605 (GRCm39) splice site probably benign
IGL01093:Alpk2 APN 18 65,482,400 (GRCm39) missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65,439,673 (GRCm39) missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65,440,211 (GRCm39) missense probably benign 0.09
IGL01370:Alpk2 APN 18 65,483,662 (GRCm39) missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65,440,779 (GRCm39) missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65,433,113 (GRCm39) missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65,437,824 (GRCm39) missense probably benign 0.01
IGL01983:Alpk2 APN 18 65,483,753 (GRCm39) missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65,439,146 (GRCm39) missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65,482,551 (GRCm39) missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65,483,402 (GRCm39) missense probably benign 0.02
IGL02551:Alpk2 APN 18 65,505,822 (GRCm39) missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65,440,670 (GRCm39) missense probably benign 0.12
IGL02901:Alpk2 APN 18 65,439,482 (GRCm39) missense probably benign
IGL02954:Alpk2 APN 18 65,439,207 (GRCm39) missense probably benign
IGL03257:Alpk2 APN 18 65,482,945 (GRCm39) missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65,437,937 (GRCm39) missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65,437,959 (GRCm39) missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65,439,450 (GRCm39) missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65,482,982 (GRCm39) missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65,482,982 (GRCm39) missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65,439,230 (GRCm39) missense probably benign 0.04
R0546:Alpk2 UTSW 18 65,439,788 (GRCm39) missense probably benign 0.05
R0628:Alpk2 UTSW 18 65,440,367 (GRCm39) missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65,482,558 (GRCm39) missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65,438,461 (GRCm39) missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65,440,544 (GRCm39) missense probably benign
R1069:Alpk2 UTSW 18 65,438,085 (GRCm39) missense probably benign 0.25
R1186:Alpk2 UTSW 18 65,427,412 (GRCm39) critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65,482,376 (GRCm39) missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65,483,275 (GRCm39) missense probably benign
R1558:Alpk2 UTSW 18 65,483,301 (GRCm39) missense probably benign
R1600:Alpk2 UTSW 18 65,511,108 (GRCm39) missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65,482,944 (GRCm39) missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65,414,030 (GRCm39) missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65,427,165 (GRCm39) missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65,440,151 (GRCm39) missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65,482,845 (GRCm39) missense probably benign
R2113:Alpk2 UTSW 18 65,438,754 (GRCm39) missense probably benign 0.31
R2126:Alpk2 UTSW 18 65,483,439 (GRCm39) nonsense probably null
R2198:Alpk2 UTSW 18 65,483,255 (GRCm39) missense probably benign 0.42
R2227:Alpk2 UTSW 18 65,511,147 (GRCm39) missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65,438,234 (GRCm39) missense probably benign 0.02
R2282:Alpk2 UTSW 18 65,440,697 (GRCm39) missense probably benign
R2421:Alpk2 UTSW 18 65,439,687 (GRCm39) missense probably benign 0.00
R2512:Alpk2 UTSW 18 65,483,591 (GRCm39) missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65,483,281 (GRCm39) missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65,438,222 (GRCm39) missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65,438,282 (GRCm39) missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65,433,212 (GRCm39) missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65,424,523 (GRCm39) missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65,414,075 (GRCm39) missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65,440,035 (GRCm39) missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65,438,894 (GRCm39) missense probably benign 0.27
R4595:Alpk2 UTSW 18 65,422,819 (GRCm39) missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65,482,953 (GRCm39) missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65,483,026 (GRCm39) missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65,482,184 (GRCm39) missense probably benign
R4910:Alpk2 UTSW 18 65,399,357 (GRCm39) nonsense probably null
R5042:Alpk2 UTSW 18 65,483,579 (GRCm39) nonsense probably null
R5295:Alpk2 UTSW 18 65,438,109 (GRCm39) missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65,505,809 (GRCm39) missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65,440,083 (GRCm39) missense probably benign 0.16
R5480:Alpk2 UTSW 18 65,482,979 (GRCm39) missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65,427,425 (GRCm39) splice site probably null
R5503:Alpk2 UTSW 18 65,439,312 (GRCm39) missense probably benign 0.00
R5595:Alpk2 UTSW 18 65,399,319 (GRCm39) missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65,482,988 (GRCm39) missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65,438,532 (GRCm39) missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65,440,360 (GRCm39) missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65,414,143 (GRCm39) missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65,440,694 (GRCm39) missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65,483,591 (GRCm39) missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65,438,456 (GRCm39) missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65,438,972 (GRCm39) missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65,482,877 (GRCm39) missense probably benign 0.00
R6407:Alpk2 UTSW 18 65,422,809 (GRCm39) missense probably benign 0.22
R6487:Alpk2 UTSW 18 65,399,254 (GRCm39) missense possibly damaging 0.62
R6786:Alpk2 UTSW 18 65,439,705 (GRCm39) missense probably benign
R6833:Alpk2 UTSW 18 65,439,480 (GRCm39) missense probably benign 0.08
R6984:Alpk2 UTSW 18 65,438,749 (GRCm39) missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65,437,584 (GRCm39) missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65,399,348 (GRCm39) nonsense probably null
R7167:Alpk2 UTSW 18 65,440,049 (GRCm39) missense probably benign 0.40
R7225:Alpk2 UTSW 18 65,438,270 (GRCm39) missense probably benign 0.00
R7409:Alpk2 UTSW 18 65,440,023 (GRCm39) missense probably benign 0.01
R7533:Alpk2 UTSW 18 65,437,674 (GRCm39) missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65,439,887 (GRCm39) missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65,433,144 (GRCm39) missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65,437,637 (GRCm39) missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65,440,073 (GRCm39) missense probably benign 0.03
R7711:Alpk2 UTSW 18 65,439,555 (GRCm39) missense probably benign
R7722:Alpk2 UTSW 18 65,483,228 (GRCm39) missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65,439,325 (GRCm39) nonsense probably null
R7806:Alpk2 UTSW 18 65,482,487 (GRCm39) missense probably benign
R7953:Alpk2 UTSW 18 65,482,901 (GRCm39) missense probably damaging 1.00
R8024:Alpk2 UTSW 18 65,438,106 (GRCm39) missense probably benign 0.01
R8043:Alpk2 UTSW 18 65,482,901 (GRCm39) missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65,483,417 (GRCm39) missense probably benign 0.15
R8171:Alpk2 UTSW 18 65,439,054 (GRCm39) missense probably benign 0.00
R8280:Alpk2 UTSW 18 65,440,274 (GRCm39) missense probably benign
R8383:Alpk2 UTSW 18 65,438,469 (GRCm39) missense probably benign 0.03
R8414:Alpk2 UTSW 18 65,440,542 (GRCm39) missense possibly damaging 0.89
R8791:Alpk2 UTSW 18 65,438,597 (GRCm39) missense probably benign 0.00
R8872:Alpk2 UTSW 18 65,413,977 (GRCm39) missense probably damaging 1.00
R9352:Alpk2 UTSW 18 65,439,783 (GRCm39) missense probably benign 0.01
R9449:Alpk2 UTSW 18 65,424,464 (GRCm39) missense probably damaging 1.00
R9525:Alpk2 UTSW 18 65,399,288 (GRCm39) missense probably damaging 1.00
R9564:Alpk2 UTSW 18 65,439,014 (GRCm39) missense probably damaging 1.00
R9710:Alpk2 UTSW 18 65,482,646 (GRCm39) missense probably damaging 1.00
X0023:Alpk2 UTSW 18 65,424,471 (GRCm39) missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65,440,542 (GRCm39) missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65,440,434 (GRCm39) missense probably benign
X0064:Alpk2 UTSW 18 65,482,755 (GRCm39) missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65,438,682 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTCACAGGCTGATTCTGC -3'
(R):5'- TGTTCAGATTTCAGTCATTCCAGC -3'

Sequencing Primer
(F):5'- TGATTCTGCCCAGAGAGCAC -3'
(R):5'- GCCTCTCTCAGGAACAAT -3'
Posted On 2018-07-23