Incidental Mutation 'R6668:Fam135a'
ID527047
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24028848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 80 (V80E)
Ref Sequence ENSEMBL: ENSMUSP00000140947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000185807] [ENSMUST00000186331] [ENSMUST00000186999] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027337
AA Change: V980E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: V980E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185807
SMART Domains Protein: ENSMUSP00000140078
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Blast:LRRNT 27 60 4e-7 BLAST
low complexity region 61 72 N/A INTRINSIC
Pfam:DUF676 104 161 2.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186331
AA Change: V80E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153
AA Change: V80E

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186999
AA Change: V810E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140198
Gene: ENSMUSG00000026153
AA Change: V810E

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 1.8e-15 PFAM
Pfam:DUF3657 338 395 7.3e-8 PFAM
low complexity region 672 683 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187369
AA Change: V784E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: V784E

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187619
Predicted Effect possibly damaging
Transcript: ENSMUST00000187752
AA Change: V767E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153
AA Change: V767E

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
R7646:Fam135a UTSW 1 24028623 missense probably benign 0.06
R7661:Fam135a UTSW 1 24072762 intron probably null
R7681:Fam135a UTSW 1 24067915 missense probably benign 0.03
R7748:Fam135a UTSW 1 24028969 missense probably benign 0.00
R7845:Fam135a UTSW 1 24029657 missense probably benign 0.27
R7849:Fam135a UTSW 1 24044250 missense probably damaging 1.00
R7914:Fam135a UTSW 1 24026679 missense probably damaging 1.00
R8314:Fam135a UTSW 1 24021921 missense possibly damaging 0.84
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATCAGAAACATCTGTAGTGCTC -3'
(R):5'- TAAGCACTGAGGACCCTTTACG -3'

Sequencing Primer
(F):5'- GAAACATCTGTAGTGCTCTGAGATCC -3'
(R):5'- TGAGGACCCTTTACGGCTCG -3'
Posted On2018-07-23