Incidental Mutation 'R6668:Fmo2'
ID527048
Institutional Source Beutler Lab
Gene Symbol Fmo2
Ensembl Gene ENSMUSG00000040170
Gene Nameflavin containing monooxygenase 2
Synonyms2310008D08Rik, 2310042I22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_018881

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location162874317-162898726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 162877048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 430 (T430S)
Ref Sequence ENSEMBL: ENSMUSP00000107135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045902] [ENSMUST00000111510]
Predicted Effect probably benign
Transcript: ENSMUST00000045902
AA Change: T430S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044405
Gene: ENSMUSG00000040170
AA Change: T430S

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 3 230 6.4e-12 PFAM
Pfam:Pyr_redox_3 6 220 4.4e-10 PFAM
Pfam:K_oxygenase 69 233 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111510
AA Change: T430S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107135
Gene: ENSMUSG00000040170
AA Change: T430S

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 4 446 1.3e-6 PFAM
Pfam:Pyr_redox_3 6 220 8e-17 PFAM
Pfam:NAD_binding_8 7 72 4.3e-6 PFAM
Pfam:K_oxygenase 78 333 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194197
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Fmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Fmo2 APN 1 162888713 nonsense probably null
IGL01299:Fmo2 APN 1 162878030 missense probably benign
IGL02617:Fmo2 APN 1 162876921 missense probably damaging 1.00
IGL02994:Fmo2 APN 1 162880620 missense probably damaging 1.00
IGL03270:Fmo2 APN 1 162882026 missense probably damaging 1.00
F5493:Fmo2 UTSW 1 162880532 missense probably benign 0.41
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0501:Fmo2 UTSW 1 162876928 missense probably benign 0.00
R0658:Fmo2 UTSW 1 162876774 missense possibly damaging 0.57
R0800:Fmo2 UTSW 1 162876814 missense probably benign 0.00
R2223:Fmo2 UTSW 1 162898244 missense probably damaging 1.00
R4360:Fmo2 UTSW 1 162882014 missense probably damaging 0.99
R4523:Fmo2 UTSW 1 162887708 missense probably benign 0.44
R4755:Fmo2 UTSW 1 162888805 missense probably damaging 1.00
R6087:Fmo2 UTSW 1 162880433 missense probably benign 0.45
R6219:Fmo2 UTSW 1 162880516 missense probably damaging 0.97
R7042:Fmo2 UTSW 1 162880657 missense probably damaging 1.00
R7291:Fmo2 UTSW 1 162887702 missense probably benign 0.06
R7560:Fmo2 UTSW 1 162888749 missense probably damaging 1.00
R7580:Fmo2 UTSW 1 162877044 missense possibly damaging 0.46
R7657:Fmo2 UTSW 1 162888844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTTCAGGATCCTCTGCTTC -3'
(R):5'- ATCTGAGATACAAACCTCCTGATGG -3'

Sequencing Primer
(F):5'- CAGGATCCTCTGCTTCTGGGTG -3'
(R):5'- TGATGGAACCTCCCAGAGATTCATTC -3'
Posted On2018-07-23