Incidental Mutation 'R6668:Gm10134'
ID527051
Institutional Source Beutler Lab
Gene Symbol Gm10134
Ensembl Gene ENSMUSG00000063611
Gene Namepredicted gene 10134
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6668 (G1)
Quality Score134.008
Status Validated
Chromosome2
Chromosomal Location28506095-28506475 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28506251 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 53 (R53*)
Ref Sequence ENSEMBL: ENSMUSP00000082978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028172] [ENSMUST00000074761] [ENSMUST00000163121]
Predicted Effect probably benign
Transcript: ENSMUST00000028172
SMART Domains Protein: ENSMUSP00000028172
Gene: ENSMUSG00000026829

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_6 33 347 1.6e-154 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074761
AA Change: R53*
SMART Domains Protein: ENSMUSP00000082978
Gene: ENSMUSG00000063611
AA Change: R53*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127958
Predicted Effect probably benign
Transcript: ENSMUST00000163121
SMART Domains Protein: ENSMUSP00000127071
Gene: ENSMUSG00000026829

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 11 347 1.9e-152 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Gm10134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Gm10134 APN 2 28506417 unclassified probably benign
R2339:Gm10134 UTSW 2 28506129 missense probably benign 0.34
R5288:Gm10134 UTSW 2 28506360 unclassified probably benign
R5385:Gm10134 UTSW 2 28506360 unclassified probably benign
R5994:Gm10134 UTSW 2 28506246 missense probably damaging 0.98
R7594:Gm10134 UTSW 2 28506360 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCAGTCTAGATAATTCTGGG -3'
(R):5'- TAGGTGTGGCACATCTGTCC -3'

Sequencing Primer
(F):5'- CCAGTCTAGATAATTCTGGGGAATAC -3'
(R):5'- TGTGGCACATCTGTCCACAGG -3'
Posted On2018-07-23