Incidental Mutation 'R6668:Adam26b'
ID527065
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43520690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 425 (V425D)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080135
AA Change: V425D

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: V425D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7993:Adam26b UTSW 8 43520208 missense probably benign 0.13
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGCAAGGGATTCCGTCTG -3'
(R):5'- CTGTCTAATGGCCCCATATAAAAC -3'

Sequencing Primer
(F):5'- AAGGGATTCCGTCTGCTTTATACAC -3'
(R):5'- TCTCCAAAATTCAGCAACTGTAG -3'
Posted On2018-07-23