Incidental Mutation 'R6668:Spata2l'
ID527066
Institutional Source Beutler Lab
Gene Symbol Spata2l
Ensembl Gene ENSMUSG00000033594
Gene Namespermatogenesis associated 2-like
Synonyms2610039E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6668 (G1)
Quality Score168.009
Status Validated
Chromosome8
Chromosomal Location123229801-123236233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123233428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 374 (D374G)
Ref Sequence ENSEMBL: ENSMUSP00000130306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036880] [ENSMUST00000098327] [ENSMUST00000127664] [ENSMUST00000166768] [ENSMUST00000212193] [ENSMUST00000212361] [ENSMUST00000212818] [ENSMUST00000213005]
Predicted Effect probably benign
Transcript: ENSMUST00000036880
SMART Domains Protein: ENSMUSP00000045527
Gene: ENSMUSG00000033862

DomainStartEndE-ValueType
S_TKc 39 323 1.52e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098327
AA Change: D374G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095932
Gene: ENSMUSG00000033594
AA Change: D374G

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166768
AA Change: D374G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130306
Gene: ENSMUSG00000033594
AA Change: D374G

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212021
Predicted Effect probably benign
Transcript: ENSMUST00000212193
Predicted Effect probably benign
Transcript: ENSMUST00000212361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212784
Predicted Effect probably benign
Transcript: ENSMUST00000212818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212904
Predicted Effect probably benign
Transcript: ENSMUST00000213005
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Spata2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Spata2l APN 8 123233977 missense possibly damaging 0.79
IGL01764:Spata2l APN 8 123234175 missense probably benign 0.16
IGL02145:Spata2l APN 8 123234031 missense possibly damaging 0.83
IGL03145:Spata2l APN 8 123233336 missense possibly damaging 0.73
R0333:Spata2l UTSW 8 123233632 missense probably damaging 1.00
R1351:Spata2l UTSW 8 123233333 missense probably damaging 1.00
R1647:Spata2l UTSW 8 123233302 missense probably benign
R4420:Spata2l UTSW 8 123234029 missense possibly damaging 0.80
R5161:Spata2l UTSW 8 123235549 missense probably damaging 1.00
R5770:Spata2l UTSW 8 123235720 missense probably damaging 0.98
R6885:Spata2l UTSW 8 123235558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGGTCCTTTTCCAAAAGAAGC -3'
(R):5'- TCGCTCAGGAGACTTAGCTC -3'

Sequencing Primer
(F):5'- GGAAACTGTCCCCAAAATTGTTG -3'
(R):5'- AGACTTAGCTCCCCCTGAG -3'
Posted On2018-07-23