Incidental Mutation 'R6668:Ryk'
ID527071
Institutional Source Beutler Lab
Gene Symbol Ryk
Ensembl Gene ENSMUSG00000032547
Gene Namereceptor-like tyrosine kinase
SynonymsVik, ERK-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location102834917-102908305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102869276 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 137 (F137I)
Ref Sequence ENSEMBL: ENSMUSP00000135858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035142] [ENSMUST00000175883] [ENSMUST00000176198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035142
AA Change: F137I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035142
Gene: ENSMUSG00000032547
AA Change: F137I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 314 580 1.76e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175788
Predicted Effect possibly damaging
Transcript: ENSMUST00000175883
AA Change: F137I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135858
Gene: ENSMUSG00000032547
AA Change: F137I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 317 583 1.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176198
SMART Domains Protein: ENSMUSP00000135396
Gene: ENSMUSG00000032547

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Meta Mutation Damage Score 0.1980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an atypical member of the family of growth factor receptor protein tyrosine kinases, differing from other members at a number of conserved residues in the activation and nucleotide binding domains. This gene product belongs to a subfamily whose members do not appear to be regulated by phosphorylation in the activation segment. It has been suggested that mediation of biological activity by recruitment of a signaling-competent auxiliary protein may occur through an as yet uncharacterized mechanism. The encoded protein has a leucine-rich extracellular domain with a WIF-type Wnt binding region, a single transmembrane domain, and an intracellular tyrosine kinase domain. This protein is involved in stimulating Wnt signaling pathways such as the regulation of axon pathfinding. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice have a distinctive craniofacial appearance, shortened limbs and postnatal mortality due to feeding and respiratory complications associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Ryk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ryk APN 9 102897266 missense probably benign 0.38
R1168:Ryk UTSW 9 102898475 missense probably damaging 1.00
R1827:Ryk UTSW 9 102888507 missense probably benign 0.03
R2030:Ryk UTSW 9 102881656 missense possibly damaging 0.90
R2084:Ryk UTSW 9 102875772 missense probably damaging 1.00
R3870:Ryk UTSW 9 102891228 missense probably damaging 0.96
R4675:Ryk UTSW 9 102891216 missense possibly damaging 0.94
R5195:Ryk UTSW 9 102867613 missense probably benign 0.00
R5338:Ryk UTSW 9 102897317 nonsense probably null
R5469:Ryk UTSW 9 102906954 missense possibly damaging 0.76
R7340:Ryk UTSW 9 102898538 missense probably damaging 0.99
R7545:Ryk UTSW 9 102888473 missense probably damaging 1.00
R7602:Ryk UTSW 9 102898516 missense probably damaging 1.00
R7694:Ryk UTSW 9 102898780 missense probably damaging 1.00
R7817:Ryk UTSW 9 102891233 nonsense probably null
X0020:Ryk UTSW 9 102881743 missense probably damaging 0.96
X0066:Ryk UTSW 9 102869410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATGCAGGTGTCCAGAGCG -3'
(R):5'- CCAGAGTTTCATCCACTAATGCG -3'

Sequencing Primer
(F):5'- TCCAGAGCGGTGGTGACAG -3'
(R):5'- CAAGACTTGGTCATGCTTAAATCTC -3'
Posted On2018-07-23