Incidental Mutation 'R6668:Bcas3'
List |< first << previous [record 6 of 40] next >> last >|
ID527076
Institutional Source Beutler Lab
Gene Symbol Bcas3
Ensembl Gene ENSMUSG00000059439
Gene Namebreast carcinoma amplified sequence 3
Synonyms2610028P08Rik, 1500019F07Rik, rudhira, K20D4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location85353167-85826058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85801851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 354 (R354Q)
Ref Sequence ENSEMBL: ENSMUSP00000090497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074875] [ENSMUST00000092821] [ENSMUST00000092822] [ENSMUST00000108061] [ENSMUST00000108062]
Predicted Effect probably benign
Transcript: ENSMUST00000074875
AA Change: R846Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074416
Gene: ENSMUSG00000059439
AA Change: R846Q

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 792 2.3e-33 PFAM
low complexity region 885 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092821
AA Change: R831Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090496
Gene: ENSMUSG00000059439
AA Change: R831Q

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 776 3.8e-35 PFAM
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092822
AA Change: R354Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090497
Gene: ENSMUSG00000059439
AA Change: R354Q

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
Pfam:BCAS3 44 298 1.2e-35 PFAM
low complexity region 415 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108061
AA Change: R846Q

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103696
Gene: ENSMUSG00000059439
AA Change: R846Q

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 789 1e-33 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108062
AA Change: R846Q

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103697
Gene: ENSMUSG00000059439
AA Change: R846Q

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 796 1.3e-28 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140673
Predicted Effect unknown
Transcript: ENSMUST00000142596
AA Change: R372Q
SMART Domains Protein: ENSMUSP00000122571
Gene: ENSMUSG00000059439
AA Change: R372Q

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
Pfam:BCAS3 48 323 3e-29 PFAM
low complexity region 434 450 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149662
AA Change: R10Q
SMART Domains Protein: ENSMUSP00000120891
Gene: ENSMUSG00000059439
AA Change: R10Q

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154396
AA Change: R610Q
SMART Domains Protein: ENSMUSP00000122154
Gene: ENSMUSG00000059439
AA Change: R610Q

DomainStartEndE-ValueType
WD40 120 160 7.7e-1 SMART
WD40 170 213 2.47e1 SMART
low complexity region 260 274 N/A INTRINSIC
low complexity region 285 294 N/A INTRINSIC
Pfam:BCAS3 301 561 1e-30 PFAM
low complexity region 650 666 N/A INTRINSIC
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Bcas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Bcas3 APN 11 85365591 missense probably damaging 0.98
IGL00754:Bcas3 APN 11 85495823 splice site probably benign
IGL01712:Bcas3 APN 11 85581048 missense probably damaging 0.99
IGL02073:Bcas3 APN 11 85557437 missense probably damaging 1.00
IGL02261:Bcas3 APN 11 85531930 missense probably damaging 1.00
IGL02323:Bcas3 APN 11 85495845 missense probably damaging 0.97
IGL02493:Bcas3 APN 11 85495882 missense probably damaging 0.99
IGL02609:Bcas3 APN 11 85457894 missense probably damaging 1.00
IGL02808:Bcas3 APN 11 85495851 missense probably benign 0.02
IGL03085:Bcas3 APN 11 85476783 missense probably damaging 1.00
IGL03263:Bcas3 APN 11 85822122 intron probably benign
FR4340:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4342:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4589:Bcas3 UTSW 11 85509497 missense probably benign 0.12
IGL02991:Bcas3 UTSW 11 85457887 nonsense probably null
PIT4377001:Bcas3 UTSW 11 85495842 missense probably damaging 0.98
PIT4472001:Bcas3 UTSW 11 85531900 missense probably damaging 0.99
R0145:Bcas3 UTSW 11 85359610 splice site probably benign
R0257:Bcas3 UTSW 11 85822039 missense probably benign 0.00
R0276:Bcas3 UTSW 11 85470837 critical splice donor site probably null
R0485:Bcas3 UTSW 11 85495850 missense probably damaging 0.99
R1053:Bcas3 UTSW 11 85557410 missense probably benign 0.10
R1833:Bcas3 UTSW 11 85583949 missense probably benign 0.00
R2107:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2108:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2215:Bcas3 UTSW 11 85801943 missense probably damaging 0.99
R2404:Bcas3 UTSW 11 85354889 splice site probably benign
R2413:Bcas3 UTSW 11 85531855 missense probably damaging 1.00
R3694:Bcas3 UTSW 11 85801802 missense probably benign 0.00
R3880:Bcas3 UTSW 11 85371122 missense probably benign 0.02
R4241:Bcas3 UTSW 11 85470826 missense probably damaging 0.99
R4794:Bcas3 UTSW 11 85509468 missense probably damaging 1.00
R5035:Bcas3 UTSW 11 85543945 missense probably damaging 1.00
R5073:Bcas3 UTSW 11 85371132 missense probably damaging 1.00
R5245:Bcas3 UTSW 11 85559086 missense probably damaging 1.00
R5358:Bcas3 UTSW 11 85451755 missense probably benign 0.02
R5395:Bcas3 UTSW 11 85825249 missense probably damaging 0.99
R5615:Bcas3 UTSW 11 85470761 missense probably damaging 1.00
R5753:Bcas3 UTSW 11 85822084 intron probably benign
R6198:Bcas3 UTSW 11 85509435 missense probably damaging 0.99
R7170:Bcas3 UTSW 11 85495918 missense probably damaging 0.96
R7171:Bcas3 UTSW 11 85583937 missense probably damaging 1.00
R7672:Bcas3 UTSW 11 85395387 nonsense probably null
R7689:Bcas3 UTSW 11 85495887 missense probably benign 0.10
R7912:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
R7993:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
V3553:Bcas3 UTSW 11 85822100 intron probably benign
X0020:Bcas3 UTSW 11 85531808 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTAGTGGCCCTGGACATGAC -3'
(R):5'- ATAATGGGCAGCACTCAGG -3'

Sequencing Primer
(F):5'- CTGGACATGACAGGACACAAG -3'
(R):5'- CTGCCTAGCCAGGGAAACATG -3'
Posted On2018-07-23