Incidental Mutation 'R6668:Prss16'
List |< first << previous [record 28 of 40] next >> last >|
ID527078
Institutional Source Beutler Lab
Gene Symbol Prss16
Ensembl Gene ENSMUSG00000006179
Gene Nameprotease, serine 16 (thymus)
SynonymsTSSP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location22002173-22009742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22006748 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 238 (E238G)
Ref Sequence ENSEMBL: ENSMUSP00000006341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]
Predicted Effect probably null
Transcript: ENSMUST00000006341
AA Change: E238G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179
AA Change: E238G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:Peptidase_S28 63 493 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130585
Predicted Effect probably benign
Transcript: ENSMUST00000150547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223857
Meta Mutation Damage Score 0.1058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Prss16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Prss16 APN 13 22003021 missense probably damaging 0.99
IGL02272:Prss16 APN 13 22003035 missense probably damaging 0.96
IGL02383:Prss16 APN 13 22009527 missense probably benign 0.00
IGL02892:Prss16 APN 13 22003050 missense probably benign 0.03
IGL03325:Prss16 APN 13 22003247 missense possibly damaging 0.90
R0645:Prss16 UTSW 13 22009376 unclassified probably benign
R0970:Prss16 UTSW 13 22005117 missense probably damaging 1.00
R1146:Prss16 UTSW 13 22006968 unclassified probably benign
R1292:Prss16 UTSW 13 22009521 nonsense probably null
R1371:Prss16 UTSW 13 22008686 unclassified probably benign
R1525:Prss16 UTSW 13 22009443 missense possibly damaging 0.50
R1624:Prss16 UTSW 13 22003313 missense probably benign 0.31
R2233:Prss16 UTSW 13 22009409 missense possibly damaging 0.70
R5147:Prss16 UTSW 13 22006094 missense possibly damaging 0.70
R5670:Prss16 UTSW 13 22003051 missense possibly damaging 0.74
R6440:Prss16 UTSW 13 22003160 missense probably damaging 0.97
R6791:Prss16 UTSW 13 22006067 missense probably damaging 0.99
R7278:Prss16 UTSW 13 22003147 missense probably damaging 1.00
Z1176:Prss16 UTSW 13 22006054 nonsense probably null
Z1176:Prss16 UTSW 13 22006400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCTAGAAGCTTCCTCAGTTTTCAG -3'
(R):5'- TTGTACTAGGCTGACGCTCC -3'

Sequencing Primer
(F):5'- AGTTTTCAGTTCCAGCAGCTTG -3'
(R):5'- AGTCTTTGCCGCCGTCG -3'
Posted On2018-07-23