Incidental Mutation 'R6668:Zfp273'
List |< first << previous [record 38 of 40] next >> last >|
ID527079
Institutional Source Beutler Lab
Gene Symbol Zfp273
Ensembl Gene ENSMUSG00000030446
Gene Namezinc finger protein 273
Synonyms6820416H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67813740-67827002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 67825124 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 124 (L124V)
Ref Sequence ENSEMBL: ENSMUSP00000137903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012725] [ENSMUST00000181391]
Predicted Effect probably benign
Transcript: ENSMUST00000012725
AA Change: L91V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000012725
Gene: ENSMUSG00000030446
AA Change: L91V

DomainStartEndE-ValueType
KRAB 1 32 1.97e-1 SMART
ZnF_C2H2 48 70 1.95e-3 SMART
ZnF_C2H2 76 98 4.94e-5 SMART
ZnF_C2H2 104 126 6.32e-3 SMART
ZnF_C2H2 132 154 3.39e-3 SMART
ZnF_C2H2 160 182 2.99e-4 SMART
ZnF_C2H2 188 210 4.24e-4 SMART
ZnF_C2H2 216 238 1.45e-2 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.91e-2 SMART
ZnF_C2H2 300 322 6.78e-3 SMART
ZnF_C2H2 328 350 2.71e-2 SMART
ZnF_C2H2 356 378 4.17e-3 SMART
ZnF_C2H2 384 406 1.38e-3 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181391
AA Change: L124V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137903
Gene: ENSMUSG00000030446
AA Change: L124V

DomainStartEndE-ValueType
KRAB 5 65 9.25e-28 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 4.94e-5 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 3.39e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 4.24e-4 SMART
ZnF_C2H2 249 271 1.45e-2 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 2.91e-2 SMART
ZnF_C2H2 333 355 6.78e-3 SMART
ZnF_C2H2 361 383 2.71e-2 SMART
ZnF_C2H2 389 411 4.17e-3 SMART
ZnF_C2H2 417 439 1.38e-3 SMART
ZnF_C2H2 445 467 1.98e-4 SMART
ZnF_C2H2 473 495 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181912
Meta Mutation Damage Score 0.7229 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Zfp273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp273 APN 13 67825650 missense probably damaging 1.00
R1969:Zfp273 UTSW 13 67825163 missense probably damaging 1.00
R2679:Zfp273 UTSW 13 67825776 missense probably benign 0.39
R3736:Zfp273 UTSW 13 67825507 nonsense probably null
R4832:Zfp273 UTSW 13 67825365 missense probably benign 0.01
R4896:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5004:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5223:Zfp273 UTSW 13 67826179 missense probably damaging 1.00
R5748:Zfp273 UTSW 13 67825331 missense probably damaging 1.00
R5948:Zfp273 UTSW 13 67825799 missense probably benign 0.43
R6102:Zfp273 UTSW 13 67822347 missense probably damaging 1.00
R7192:Zfp273 UTSW 13 67825064 missense possibly damaging 0.82
R7478:Zfp273 UTSW 13 67825132 missense probably benign 0.30
R7792:Zfp273 UTSW 13 67826016 missense possibly damaging 0.71
R7874:Zfp273 UTSW 13 67825439 missense probably benign 0.00
R7957:Zfp273 UTSW 13 67825439 missense probably benign 0.00
X0028:Zfp273 UTSW 13 67823142 missense probably benign 0.20
Z1088:Zfp273 UTSW 13 67825394 missense possibly damaging 0.91
Z1176:Zfp273 UTSW 13 67823146 missense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGGTAGGCGGATTTCTG -3'
(R):5'- ACATTTGTAGGGTTTCTCTCCAGTAT -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CTCTTCGGTGAACAATAAGTCCTG -3'
Posted On2018-07-23