Incidental Mutation 'R6668:Zfp994'
List |< first << previous [record 40 of 40]
ID527082
Institutional Source Beutler Lab
Gene Symbol Zfp994
Ensembl Gene ENSMUSG00000096433
Gene Namezinc finger protein 994
SynonymsGm4944
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location22197265-22225614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22201100 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 289 (H289Q)
Ref Sequence ENSEMBL: ENSMUSP00000136105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179996]
Predicted Effect probably damaging
Transcript: ENSMUST00000179996
AA Change: H289Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136105
Gene: ENSMUSG00000096433
AA Change: H289Q

DomainStartEndE-ValueType
KRAB 13 73 3.33e-20 SMART
ZnF_C2H2 183 205 8.09e-1 SMART
ZnF_C2H2 211 233 1.84e-4 SMART
ZnF_C2H2 239 261 2.99e-4 SMART
ZnF_C2H2 267 289 1.04e-3 SMART
ZnF_C2H2 295 317 2.61e-4 SMART
ZnF_C2H2 323 345 4.3e-5 SMART
ZnF_C2H2 351 373 6.78e-3 SMART
ZnF_C2H2 379 401 1.12e-3 SMART
ZnF_C2H2 407 429 5.5e-3 SMART
ZnF_C2H2 435 457 1.3e-4 SMART
ZnF_C2H2 463 485 1.67e-2 SMART
ZnF_C2H2 491 513 1.47e-3 SMART
ZnF_C2H2 519 541 2.4e-3 SMART
ZnF_C2H2 547 569 7.67e-2 SMART
ZnF_C2H2 575 597 8.6e-5 SMART
ZnF_C2H2 603 625 8.02e-5 SMART
ZnF_C2H2 631 653 9.22e-5 SMART
Meta Mutation Damage Score 0.6209 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Other mutations in Zfp994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Zfp994 APN 17 22202680 missense probably damaging 0.98
R0361:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R0498:Zfp994 UTSW 17 22200901 missense probably damaging 0.99
R0567:Zfp994 UTSW 17 22200468 missense possibly damaging 0.82
R1075:Zfp994 UTSW 17 22200945 missense probably damaging 1.00
R1561:Zfp994 UTSW 17 22201225 missense probably damaging 1.00
R2117:Zfp994 UTSW 17 22200981 missense probably damaging 1.00
R2313:Zfp994 UTSW 17 22201285 missense probably damaging 1.00
R4486:Zfp994 UTSW 17 22201560 missense probably damaging 1.00
R4906:Zfp994 UTSW 17 22200467 nonsense probably null
R4924:Zfp994 UTSW 17 22200757 missense probably damaging 0.98
R5394:Zfp994 UTSW 17 22200525 missense probably damaging 1.00
R5560:Zfp994 UTSW 17 22201713 missense possibly damaging 0.62
R5746:Zfp994 UTSW 17 22201273 missense probably damaging 0.99
R6275:Zfp994 UTSW 17 22199991 nonsense probably null
R6459:Zfp994 UTSW 17 22200546 missense possibly damaging 0.83
R7343:Zfp994 UTSW 17 22200068 missense probably benign 0.12
R7625:Zfp994 UTSW 17 22201755 missense possibly damaging 0.85
R7709:Zfp994 UTSW 17 22200425 missense probably benign 0.00
R7725:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R7756:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7758:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R8033:Zfp994 UTSW 17 22200684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCCTTTGTCACATTCACTAC -3'
(R):5'- TACAATGGTGCAAAGCTTGATAAGG -3'

Sequencing Primer
(F):5'- GTCACATTCACTACATCTGTAAGG -3'
(R):5'- TGTGCCAAATGTTTTGCCAAG -3'
Posted On2018-07-23