Incidental Mutation 'R6668:Mlst8'
List |< first << previous [record 19 of 40] next >> last >|
ID527083
Institutional Source Beutler Lab
Gene Symbol Mlst8
Ensembl Gene ENSMUSG00000024142
Gene NameMTOR associated protein, LST8 homolog (S. cerevisiae)
SynonymsGbl, mLST8, 0610033N12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24473550-24479078 bp(-) (GRCm38)
Type of Mutationunclassified (2092 bp from exon)
DNA Base Change (assembly) A to G at 24477479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054946] [ENSMUST00000070888] [ENSMUST00000164508] [ENSMUST00000179163]
Predicted Effect probably null
Transcript: ENSMUST00000054946
SMART Domains Protein: ENSMUSP00000059792
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070888
AA Change: I124T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065004
Gene: ENSMUSG00000024142
AA Change: I124T

DomainStartEndE-ValueType
Blast:WD40 1 28 6e-11 BLAST
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164508
SMART Domains Protein: ENSMUSP00000130417
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179163
AA Change: I124T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136287
Gene: ENSMUSG00000024142
AA Change: I124T

DomainStartEndE-ValueType
Pfam:WD40 8 28 3.7e-3 PFAM
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Meta Mutation Damage Score 0.1043 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit lethality around E10.5 and abnormal yolk sac vasculature, brain development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Mlst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Mlst8 APN 17 24477313 missense probably damaging 1.00
IGL01893:Mlst8 APN 17 24477987 missense probably benign 0.02
IGL02984:Mlst8 UTSW 17 24476153 missense probably damaging 0.98
R0104:Mlst8 UTSW 17 24476117 missense possibly damaging 0.55
R0104:Mlst8 UTSW 17 24476117 missense possibly damaging 0.55
R1915:Mlst8 UTSW 17 24477290 nonsense probably null
R1952:Mlst8 UTSW 17 24478013 frame shift probably null
R1953:Mlst8 UTSW 17 24478013 frame shift probably null
R1954:Mlst8 UTSW 17 24477221 missense probably damaging 1.00
R3405:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R3406:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R4517:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
R5021:Mlst8 UTSW 17 24477219 missense possibly damaging 0.93
R6344:Mlst8 UTSW 17 24477326 missense probably damaging 1.00
R6490:Mlst8 UTSW 17 24477961 missense probably benign 0.01
R6931:Mlst8 UTSW 17 24477275 missense probably damaging 1.00
R7596:Mlst8 UTSW 17 24478110 critical splice donor site probably null
R7685:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCAGCTGCTCATTGTGGTC -3'
(R):5'- TTCACTGACCTCAAGCTTGTG -3'

Sequencing Primer
(F):5'- ATGTGGATAGCACCGCTCTGATC -3'
(R):5'- CTTGTGGAGAAAGAGCTAAACTTCAC -3'
Posted On2018-07-23