Incidental Mutation 'R6668:Zfp608'
ID527084
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Namezinc finger protein 608
Synonyms4932417D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location54888045-54990180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54898019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 950 (S950P)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
Predicted Effect probably damaging
Transcript: ENSMUST00000064763
AA Change: S950P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: S950P

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 54988333 missense probably benign
IGL00920:Zfp608 APN 18 54889831 missense probably benign 0.00
IGL01088:Zfp608 APN 18 54898087 missense probably benign 0.03
IGL01447:Zfp608 APN 18 54899011 missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 54898932 missense probably damaging 0.99
IGL01547:Zfp608 APN 18 54894449 critical splice donor site probably null
IGL01933:Zfp608 APN 18 54987799 missense probably benign
IGL01998:Zfp608 APN 18 54891818 missense probably damaging 0.99
IGL02167:Zfp608 APN 18 54988224 missense probably damaging 1.00
IGL02266:Zfp608 APN 18 54897581 missense probably benign 0.08
IGL02335:Zfp608 APN 18 54897437 nonsense probably null
IGL02455:Zfp608 APN 18 54899333 missense probably damaging 1.00
IGL02612:Zfp608 APN 18 54898201 missense probably damaging 1.00
IGL02900:Zfp608 APN 18 54946793 missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 54898024 missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 54946711 missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 54895520 missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0064:Zfp608 UTSW 18 54898816 missense probably benign
R0401:Zfp608 UTSW 18 54898994 missense probably benign
R0722:Zfp608 UTSW 18 54900234 missense probably damaging 1.00
R1351:Zfp608 UTSW 18 54898391 missense probably benign 0.00
R1512:Zfp608 UTSW 18 54946666 missense probably damaging 1.00
R1554:Zfp608 UTSW 18 54898054 missense probably damaging 1.00
R1622:Zfp608 UTSW 18 54988294 missense probably benign 0.07
R1669:Zfp608 UTSW 18 54987739 missense probably benign 0.09
R1690:Zfp608 UTSW 18 54987634 missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 54899249 missense probably benign
R1826:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R1864:Zfp608 UTSW 18 54897911 missense probably benign 0.00
R1952:Zfp608 UTSW 18 54897779 nonsense probably null
R2049:Zfp608 UTSW 18 54895565 missense probably damaging 1.00
R2051:Zfp608 UTSW 18 54988314 missense probably benign
R2168:Zfp608 UTSW 18 54898053 nonsense probably null
R2218:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R2283:Zfp608 UTSW 18 54988374 missense probably damaging 1.00
R2399:Zfp608 UTSW 18 54897902 missense probably damaging 1.00
R2520:Zfp608 UTSW 18 54988506 missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 54898472 missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4076:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4206:Zfp608 UTSW 18 54988195 missense probably damaging 1.00
R4756:Zfp608 UTSW 18 54894472 missense probably damaging 1.00
R4771:Zfp608 UTSW 18 54988300 missense probably benign
R4820:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R4825:Zfp608 UTSW 18 54897969 missense probably benign 0.01
R4912:Zfp608 UTSW 18 54946591 missense probably damaging 1.00
R4975:Zfp608 UTSW 18 54889890 missense probably damaging 1.00
R5138:Zfp608 UTSW 18 54891799 missense probably damaging 1.00
R5192:Zfp608 UTSW 18 54898497 missense probably damaging 1.00
R5557:Zfp608 UTSW 18 54987870 missense possibly damaging 0.81
R5624:Zfp608 UTSW 18 54898272 missense probably damaging 1.00
R5818:Zfp608 UTSW 18 54895396 missense probably benign 0.02
R5840:Zfp608 UTSW 18 54898906 missense probably damaging 1.00
R5992:Zfp608 UTSW 18 54899248 missense probably benign 0.15
R6106:Zfp608 UTSW 18 54987872 missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 54988544 start gained probably benign
R6181:Zfp608 UTSW 18 54895628 missense possibly damaging 0.56
R6517:Zfp608 UTSW 18 54899078 missense possibly damaging 0.94
R6567:Zfp608 UTSW 18 54897556 missense probably damaging 1.00
R6920:Zfp608 UTSW 18 54988265 missense probably damaging 1.00
R7061:Zfp608 UTSW 18 54987997 missense probably benign
R7074:Zfp608 UTSW 18 54897382 missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 54899397 missense probably damaging 1.00
R7391:Zfp608 UTSW 18 54897547 missense possibly damaging 0.49
R7600:Zfp608 UTSW 18 54988020 missense probably damaging 1.00
R7723:Zfp608 UTSW 18 54897601 missense probably damaging 1.00
R8054:Zfp608 UTSW 18 54899546 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGGGTGCATGTAACTCGGAG -3'
(R):5'- CATCAAAGCCGAGGCCGATAAG -3'

Sequencing Primer
(F):5'- TGTAACTCGGAGAATAGTAAGGCTC -3'
(R):5'- CGAGGCCGATAAGGTTTACACATTC -3'
Posted On2018-07-23