Incidental Mutation 'R6670:Ubr1'
ID 527088
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission 044790-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R6670 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120690750-120801196 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120754611 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably null
Transcript: ENSMUST00000028728
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154023
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,827,850 (GRCm39) 1544 probably benign Het
Acsm3 T A 7: 119,379,978 (GRCm39) probably null Het
AW551984 T C 9: 39,504,292 (GRCm39) D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,418,369 (GRCm39) probably benign Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Ccdc12 T G 9: 110,537,595 (GRCm39) probably null Het
Ctsl T C 13: 64,511,916 (GRCm39) probably null Het
Cul1 T A 6: 47,494,068 (GRCm39) D460E probably damaging Het
Dnttip2 T A 3: 122,069,870 (GRCm39) S362T probably damaging Het
Fbxw16 T A 9: 109,267,280 (GRCm39) D317V probably damaging Het
Fbxw9 T A 8: 85,788,839 (GRCm39) N196K possibly damaging Het
Grap A G 11: 61,551,064 (GRCm39) D32G probably damaging Het
Hhatl T C 9: 121,618,137 (GRCm39) D206G probably damaging Het
Hrnr A T 3: 93,239,192 (GRCm39) Q3143H unknown Het
Ighv1-62-1 T C 12: 115,350,529 (GRCm39) Y46C probably damaging Het
Krtap16-3 A T 16: 88,759,540 (GRCm39) Y58N unknown Het
Mef2c A G 13: 83,810,716 (GRCm39) K384R probably damaging Het
Nalcn A G 14: 123,702,084 (GRCm39) Y476H possibly damaging Het
Oxgr1 A T 14: 120,259,669 (GRCm39) N179K probably damaging Het
Polk G A 13: 96,633,138 (GRCm39) Q302* probably null Het
Rab3gap1 T A 1: 127,858,512 (GRCm39) S540R probably benign Het
Samd5 A T 10: 9,504,808 (GRCm39) probably null Het
Sema6d GTGATAC G 2: 124,496,762 (GRCm39) probably benign Het
Slc1a6 C A 10: 78,623,646 (GRCm39) A15D probably benign Het
Slc8a1 A G 17: 81,956,883 (GRCm39) C52R probably damaging Het
Sod2 T A 17: 13,227,252 (GRCm39) Y69N possibly damaging Het
Tank T C 2: 61,474,768 (GRCm39) probably null Het
Tbc1d23 A T 16: 57,034,580 (GRCm39) I73N probably benign Het
Tnf A C 17: 35,420,800 (GRCm39) M6R possibly damaging Het
Trmt2a C T 16: 18,068,341 (GRCm39) A16V possibly damaging Het
Ttn A G 2: 76,556,055 (GRCm39) Y21990H probably damaging Het
Uaca C T 9: 60,779,306 (GRCm39) S1231L probably benign Het
Unc13b A G 4: 43,255,562 (GRCm39) D3849G probably damaging Het
Vmn2r75 T A 7: 85,797,644 (GRCm39) D723V probably damaging Het
Wnt2 C A 6: 18,028,091 (GRCm39) V48L possibly damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120,705,888 (GRCm39) missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120,771,574 (GRCm39) missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120,761,353 (GRCm39) missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120,745,386 (GRCm39) missense probably benign
IGL01346:Ubr1 APN 2 120,703,603 (GRCm39) critical splice donor site probably null
IGL01368:Ubr1 APN 2 120,771,612 (GRCm39) splice site probably benign
IGL01539:Ubr1 APN 2 120,756,494 (GRCm39) missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120,764,823 (GRCm39) missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120,705,879 (GRCm39) missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120,751,867 (GRCm39) missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120,730,989 (GRCm39) missense probably benign 0.00
IGL02208:Ubr1 APN 2 120,776,830 (GRCm39) missense probably benign 0.00
IGL02415:Ubr1 APN 2 120,801,084 (GRCm39) utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120,694,854 (GRCm39) missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120,701,460 (GRCm39) splice site probably benign
IGL02627:Ubr1 APN 2 120,771,472 (GRCm39) missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120,745,364 (GRCm39) missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120,771,572 (GRCm39) missense probably benign 0.01
IGL02939:Ubr1 APN 2 120,711,664 (GRCm39) critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120,791,637 (GRCm39) missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120,694,898 (GRCm39) missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120,725,641 (GRCm39) missense probably benign
I1329:Ubr1 UTSW 2 120,764,775 (GRCm39) splice site probably benign
R0022:Ubr1 UTSW 2 120,791,654 (GRCm39) splice site probably benign
R0345:Ubr1 UTSW 2 120,734,584 (GRCm39) splice site probably null
R0373:Ubr1 UTSW 2 120,777,138 (GRCm39) missense probably benign 0.01
R0393:Ubr1 UTSW 2 120,737,427 (GRCm39) missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120,711,574 (GRCm39) missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120,778,364 (GRCm39) nonsense probably null
R0723:Ubr1 UTSW 2 120,711,582 (GRCm39) nonsense probably null
R1178:Ubr1 UTSW 2 120,756,510 (GRCm39) nonsense probably null
R1401:Ubr1 UTSW 2 120,786,125 (GRCm39) missense probably benign 0.01
R1485:Ubr1 UTSW 2 120,791,579 (GRCm39) missense probably benign 0.03
R1572:Ubr1 UTSW 2 120,765,800 (GRCm39) splice site probably benign
R1920:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1921:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1997:Ubr1 UTSW 2 120,776,754 (GRCm39) critical splice donor site probably null
R2129:Ubr1 UTSW 2 120,773,034 (GRCm39) missense probably benign 0.35
R2147:Ubr1 UTSW 2 120,694,811 (GRCm39) missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120,756,528 (GRCm39) missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120,739,963 (GRCm39) missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120,793,929 (GRCm39) missense probably benign 0.02
R3930:Ubr1 UTSW 2 120,746,951 (GRCm39) missense probably benign 0.20
R3979:Ubr1 UTSW 2 120,693,168 (GRCm39) missense probably benign 0.11
R4172:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4173:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4174:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4241:Ubr1 UTSW 2 120,764,867 (GRCm39) missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120,801,084 (GRCm39) utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120,725,547 (GRCm39) splice site probably null
R4449:Ubr1 UTSW 2 120,776,862 (GRCm39) missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120,772,963 (GRCm39) missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120,756,494 (GRCm39) missense probably benign 0.35
R4765:Ubr1 UTSW 2 120,793,923 (GRCm39) nonsense probably null
R4928:Ubr1 UTSW 2 120,745,419 (GRCm39) missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120,794,047 (GRCm39) missense probably benign 0.00
R5033:Ubr1 UTSW 2 120,742,478 (GRCm39) critical splice donor site probably null
R5108:Ubr1 UTSW 2 120,793,903 (GRCm39) missense probably benign 0.20
R5118:Ubr1 UTSW 2 120,712,745 (GRCm39) missense probably benign 0.20
R5211:Ubr1 UTSW 2 120,723,651 (GRCm39) missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120,734,525 (GRCm39) missense probably benign 0.00
R5449:Ubr1 UTSW 2 120,793,981 (GRCm39) missense probably benign
R5452:Ubr1 UTSW 2 120,698,783 (GRCm39) missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120,745,888 (GRCm39) missense probably benign
R5610:Ubr1 UTSW 2 120,722,593 (GRCm39) missense probably benign 0.04
R5637:Ubr1 UTSW 2 120,793,998 (GRCm39) missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120,791,573 (GRCm39) missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120,734,486 (GRCm39) missense probably benign
R5979:Ubr1 UTSW 2 120,776,863 (GRCm39) missense probably benign 0.07
R6044:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R6146:Ubr1 UTSW 2 120,723,690 (GRCm39) missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120,737,376 (GRCm39) missense probably benign 0.21
R6389:Ubr1 UTSW 2 120,711,520 (GRCm39) missense probably benign 0.03
R6600:Ubr1 UTSW 2 120,745,880 (GRCm39) missense probably benign 0.00
R6731:Ubr1 UTSW 2 120,786,121 (GRCm39) missense probably null 0.99
R6836:Ubr1 UTSW 2 120,727,156 (GRCm39) splice site probably null
R6994:Ubr1 UTSW 2 120,794,074 (GRCm39) missense probably benign
R7121:Ubr1 UTSW 2 120,705,979 (GRCm39) missense probably benign 0.00
R7204:Ubr1 UTSW 2 120,734,558 (GRCm39) missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120,693,246 (GRCm39) missense probably benign 0.04
R7434:Ubr1 UTSW 2 120,693,161 (GRCm39) missense probably benign
R7457:Ubr1 UTSW 2 120,748,309 (GRCm39) missense probably benign 0.35
R7464:Ubr1 UTSW 2 120,720,255 (GRCm39) critical splice donor site probably null
R7519:Ubr1 UTSW 2 120,705,925 (GRCm39) missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120,703,672 (GRCm39) missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120,764,855 (GRCm39) missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120,764,898 (GRCm39) nonsense probably null
R8221:Ubr1 UTSW 2 120,791,585 (GRCm39) missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120,793,937 (GRCm39) missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120,741,596 (GRCm39) missense probably benign
R8293:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R8420:Ubr1 UTSW 2 120,701,476 (GRCm39) missense probably benign
R8489:Ubr1 UTSW 2 120,711,548 (GRCm39) missense probably benign 0.42
R8708:Ubr1 UTSW 2 120,696,964 (GRCm39) missense probably benign 0.27
R8856:Ubr1 UTSW 2 120,734,523 (GRCm39) missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120,697,034 (GRCm39) missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120,756,469 (GRCm39) missense probably benign 0.00
R9155:Ubr1 UTSW 2 120,754,615 (GRCm39) missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120,703,603 (GRCm39) critical splice donor site probably null
R9194:Ubr1 UTSW 2 120,778,325 (GRCm39) missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120,727,000 (GRCm39) missense probably benign 0.04
R9401:Ubr1 UTSW 2 120,765,765 (GRCm39) missense probably benign 0.06
R9430:Ubr1 UTSW 2 120,734,506 (GRCm39) missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120,703,627 (GRCm39) missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120,764,820 (GRCm39) missense probably benign 0.06
R9703:Ubr1 UTSW 2 120,732,092 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGATATCTATACCTTAACCTCC -3'
(R):5'- TGCTTGGAAGAGAACTCGAGAC -3'

Sequencing Primer
(F):5'- GGCAGAGCTCTTACCTAACATGTG -3'
(R):5'- GAGTTTGTGATTCTTACGTCAC -3'
Posted On 2018-07-23