Incidental Mutation 'R6670:Wnt2'
ID527094
Institutional Source Beutler Lab
Gene Symbol Wnt2
Ensembl Gene ENSMUSG00000010797
Gene Namewingless-type MMTV integration site family, member 2
Synonymsm-irp, Irp, 2610510E18Rik, Int1l1, Mirp, Wnt2a, Wnt-2
MMRRC Submission
Accession Numbers

Genbank: NM_023653.5; Ensembl: ENSMUST00000010941

Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location17988940-18030585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18028092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 48 (V48L)
Ref Sequence ENSEMBL: ENSMUSP00000010941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010941
AA Change: V48L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010941
Gene: ENSMUSG00000010797
AA Change: V48L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WNT1 43 349 5.1e-213 SMART
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired placental vascularization, runting and 50% perinatal mortality resulting from difficulties in breathing and nursing. Survivors of the perinatal period tend to recover, and adults are healthy and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Other mutations in Wnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03264:Wnt2 APN 6 17989960 missense probably benign 0.22
1mM(1):Wnt2 UTSW 6 18008623 missense probably damaging 1.00
R1165:Wnt2 UTSW 6 17989947 missense probably benign
R1771:Wnt2 UTSW 6 18008697 missense probably damaging 0.97
R1782:Wnt2 UTSW 6 18008640 missense possibly damaging 0.65
R1836:Wnt2 UTSW 6 18023235 missense probably damaging 1.00
R1921:Wnt2 UTSW 6 18030253 missense unknown
R2009:Wnt2 UTSW 6 18030209 missense probably damaging 0.98
R3749:Wnt2 UTSW 6 18023168 missense probably benign 0.00
R4831:Wnt2 UTSW 6 18023286 missense probably benign 0.19
R4888:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R4924:Wnt2 UTSW 6 18023240 missense probably damaging 1.00
R5121:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R5660:Wnt2 UTSW 6 18028146 missense probably benign 0.09
R5767:Wnt2 UTSW 6 17990028 missense probably damaging 0.97
R6005:Wnt2 UTSW 6 18030323 start gained probably benign
R7205:Wnt2 UTSW 6 18028047 missense probably benign 0.11
R7711:Wnt2 UTSW 6 17990037 missense probably benign 0.44
R7732:Wnt2 UTSW 6 18023336 missense probably damaging 1.00
R8249:Wnt2 UTSW 6 18030285 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CTTTGAGTACAGGTGCAGGGAG -3'
(R):5'- CCTGCCTTTTAATGTTACCAGGG -3'

Sequencing Primer
(F):5'- CCAGGAGAAGGAGACTCACTTC -3'
(R):5'- GTTACCAGGGAATAAGCAATTCATCC -3'
Posted On2018-07-23