Incidental Mutation 'R6670:Fbxw9'
ID527098
Institutional Source Beutler Lab
Gene Symbol Fbxw9
Ensembl Gene ENSMUSG00000008167
Gene NameF-box and WD-40 domain protein 9
SynonymsFbw9, 1110017H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85060055-85067124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85062210 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 196 (N196K)
Ref Sequence ENSEMBL: ENSMUSP00000092845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000095220] [ENSMUST00000166592]
Predicted Effect probably benign
Transcript: ENSMUST00000093360
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095220
AA Change: N196K

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092845
Gene: ENSMUSG00000008167
AA Change: N196K

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
FBOX 82 123 7.47e-4 SMART
WD40 161 201 2.98e-1 SMART
WD40 210 252 4.55e-3 SMART
WD40 256 292 7.8e-2 SMART
WD40 296 333 1.03e0 SMART
WD40 377 415 2.57e0 SMART
Blast:WD40 419 455 8e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably benign
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW9, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603034), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Fbxw9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Fbxw9 APN 8 85066590 missense probably damaging 0.99
IGL01108:Fbxw9 APN 8 85065977 unclassified probably benign
IGL01633:Fbxw9 APN 8 85064426 missense probably damaging 1.00
IGL02672:Fbxw9 APN 8 85066053 splice site probably null
R0053:Fbxw9 UTSW 8 85064454 missense probably damaging 1.00
R0053:Fbxw9 UTSW 8 85064454 missense probably damaging 1.00
R0535:Fbxw9 UTSW 8 85064600 missense probably damaging 1.00
R0961:Fbxw9 UTSW 8 85062029 missense probably benign 0.05
R1171:Fbxw9 UTSW 8 85066078 missense possibly damaging 0.95
R2371:Fbxw9 UTSW 8 85062029 missense probably benign 0.05
R4472:Fbxw9 UTSW 8 85060200 missense probably damaging 1.00
R4864:Fbxw9 UTSW 8 85065901 missense probably damaging 1.00
R4865:Fbxw9 UTSW 8 85060156 missense possibly damaging 0.62
R5236:Fbxw9 UTSW 8 85066345 missense probably damaging 0.98
R5771:Fbxw9 UTSW 8 85064572 splice site probably null
R6861:Fbxw9 UTSW 8 85066111 missense probably damaging 0.99
R7354:Fbxw9 UTSW 8 85062196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCGAGTACTTCTGCCTG -3'
(R):5'- TCAAGAGTTATACCAACAGTAGAGG -3'

Sequencing Primer
(F):5'- AGTACTTCTGCCTGGCTGATG -3'
(R):5'- GGTAGAGTCGAGTCTATGCAATC -3'
Posted On2018-07-23