Incidental Mutation 'R6670:Uaca'
ID527102
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60872024 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1231 (S1231L)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably benign
Transcript: ENSMUST00000050183
AA Change: S1231L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: S1231L

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214354
AA Change: S1229L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216574
Predicted Effect unknown
Transcript: ENSMUST00000217656
AA Change: S1053L
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
Ixtapa UTSW 9 60870413 missense probably damaging 0.99
oaxaca UTSW 9 60871451 missense probably benign
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
R7424:Uaca UTSW 9 60870110 missense probably damaging 1.00
R7485:Uaca UTSW 9 60846000 missense probably damaging 1.00
R7510:Uaca UTSW 9 60850205 splice site probably null
R7688:Uaca UTSW 9 60874127 missense probably benign 0.11
R7724:Uaca UTSW 9 60869905 missense probably benign 0.24
R7743:Uaca UTSW 9 60876395 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60874123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGAAGAACTCCTCGGTG -3'
(R):5'- TCGTCAGGGACTTGTCACAG -3'

Sequencing Primer
(F):5'- AAGAACTCCTCGGTGACCCTG -3'
(R):5'- AGGGACTTGTCACAGCGCTC -3'
Posted On2018-07-23