Incidental Mutation 'R6670:Grap'
ID527108
Institutional Source Beutler Lab
Gene Symbol Grap
Ensembl Gene ENSMUSG00000004837
Gene NameGRB2-related adaptor protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61653265-61672784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61660238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000004959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004959]
Predicted Effect probably damaging
Transcript: ENSMUST00000004959
AA Change: D32G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004959
Gene: ENSMUSG00000004837
AA Change: D32G

DomainStartEndE-ValueType
SH3 1 57 5.43e-18 SMART
SH2 58 141 1.9e-33 SMART
SH3 161 216 3.32e-22 SMART
Meta Mutation Damage Score 0.2978 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family and functions as a cytoplasmic signaling protein which contains an SH2 domain flanked by two SH3 domains. The SH2 domain interacts with ligand-activated receptors for stem cell factor and erythropoietin, and facilitates the formation of a stable complex with the BCR-ABL oncoprotein. This protein also associates with the Ras guanine nucleotide exchange factor SOS1 (son of sevenless homolog 1) through its N-terminal SH3 domain. In general, it couples signals from receptor and cytoplasmic tyrosine kinases to the Ras signaling pathway. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display a greater proliferative T cell response to TCR stimulation. In all other respects, they are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Grap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0833:Grap UTSW 11 61660239 missense possibly damaging 0.73
R0836:Grap UTSW 11 61660239 missense possibly damaging 0.73
R1103:Grap UTSW 11 61671718 missense probably benign 0.01
R1479:Grap UTSW 11 61660298 missense probably benign 0.26
R1869:Grap UTSW 11 61664189 missense possibly damaging 0.94
R3843:Grap UTSW 11 61660325 splice site probably null
R3903:Grap UTSW 11 61660325 splice site probably null
R4939:Grap UTSW 11 61660298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGTGTAGATGTCCACCTGC -3'
(R):5'- TCTAGCCTATCCAAGTCCCAG -3'

Sequencing Primer
(F):5'- GTAGATGTCCACCTGCCAGTATG -3'
(R):5'- AGTCAGCCAGTGCCCATC -3'
Posted On2018-07-23