Incidental Mutation 'R6670:Ighv1-62-1'
ID527109
Institutional Source Beutler Lab
Gene Symbol Ighv1-62-1
Ensembl Gene ENSMUSG00000102313
Gene Nameimmunoglobulin heavy variable 1-62-1
SynonymsGm9232
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location115386697-115387128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115386909 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 46 (Y46C)
Ref Sequence ENSEMBL: ENSMUSP00000100284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103503] [ENSMUST00000171270]
Predicted Effect probably damaging
Transcript: ENSMUST00000103503
AA Change: Y46C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100284
Gene: ENSMUSG00000102313
AA Change: Y46C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 116 4.4e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171270
AA Change: Y27C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193799
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Ighv1-62-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2571:Ighv1-62-1 UTSW 12 115386757 missense probably damaging 0.99
R4381:Ighv1-62-1 UTSW 12 115386993 missense probably benign 0.00
R6730:Ighv1-62-1 UTSW 12 115386892 missense probably benign 0.01
R7241:Ighv1-62-1 UTSW 12 115386702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTTACAACACTGTTCCTTG -3'
(R):5'- GGGGCTCACCTGTTCAAAATC -3'

Sequencing Primer
(F):5'- CCTTGCACAGATAGATTGCAG -3'
(R):5'- GGCTCACCTGTTCAAAATCTGAAATG -3'
Posted On2018-07-23