Incidental Mutation 'R6670:Ctsl'
ID 527110
Institutional Source Beutler Lab
Gene Symbol Ctsl
Ensembl Gene ENSMUSG00000021477
Gene Name cathepsin L
Synonyms MEP, 1190035F06Rik, Cat L, major excreted protein
MMRRC Submission 044790-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6670 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 64509704-64518586 bp(-) (GRCm39)
Type of Mutation splice site (990 bp from exon)
DNA Base Change (assembly) T to C at 64511916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]
AlphaFold P06797
Predicted Effect possibly damaging
Transcript: ENSMUST00000021933
AA Change: N334S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: N334S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220617
Predicted Effect probably null
Transcript: ENSMUST00000220737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221966
Predicted Effect probably benign
Transcript: ENSMUST00000222462
Predicted Effect possibly damaging
Transcript: ENSMUST00000222517
AA Change: N334S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000223494
Predicted Effect probably null
Transcript: ENSMUST00000222971
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,827,850 (GRCm39) 1544 probably benign Het
Acsm3 T A 7: 119,379,978 (GRCm39) probably null Het
AW551984 T C 9: 39,504,292 (GRCm39) D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,418,369 (GRCm39) probably benign Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Ccdc12 T G 9: 110,537,595 (GRCm39) probably null Het
Cul1 T A 6: 47,494,068 (GRCm39) D460E probably damaging Het
Dnttip2 T A 3: 122,069,870 (GRCm39) S362T probably damaging Het
Fbxw16 T A 9: 109,267,280 (GRCm39) D317V probably damaging Het
Fbxw9 T A 8: 85,788,839 (GRCm39) N196K possibly damaging Het
Grap A G 11: 61,551,064 (GRCm39) D32G probably damaging Het
Hhatl T C 9: 121,618,137 (GRCm39) D206G probably damaging Het
Hrnr A T 3: 93,239,192 (GRCm39) Q3143H unknown Het
Ighv1-62-1 T C 12: 115,350,529 (GRCm39) Y46C probably damaging Het
Krtap16-3 A T 16: 88,759,540 (GRCm39) Y58N unknown Het
Mef2c A G 13: 83,810,716 (GRCm39) K384R probably damaging Het
Nalcn A G 14: 123,702,084 (GRCm39) Y476H possibly damaging Het
Oxgr1 A T 14: 120,259,669 (GRCm39) N179K probably damaging Het
Polk G A 13: 96,633,138 (GRCm39) Q302* probably null Het
Rab3gap1 T A 1: 127,858,512 (GRCm39) S540R probably benign Het
Samd5 A T 10: 9,504,808 (GRCm39) probably null Het
Sema6d GTGATAC G 2: 124,496,762 (GRCm39) probably benign Het
Slc1a6 C A 10: 78,623,646 (GRCm39) A15D probably benign Het
Slc8a1 A G 17: 81,956,883 (GRCm39) C52R probably damaging Het
Sod2 T A 17: 13,227,252 (GRCm39) Y69N possibly damaging Het
Tank T C 2: 61,474,768 (GRCm39) probably null Het
Tbc1d23 A T 16: 57,034,580 (GRCm39) I73N probably benign Het
Tnf A C 17: 35,420,800 (GRCm39) M6R possibly damaging Het
Trmt2a C T 16: 18,068,341 (GRCm39) A16V possibly damaging Het
Ttn A G 2: 76,556,055 (GRCm39) Y21990H probably damaging Het
Uaca C T 9: 60,779,306 (GRCm39) S1231L probably benign Het
Ubr1 A G 2: 120,754,611 (GRCm39) probably null Het
Unc13b A G 4: 43,255,562 (GRCm39) D3849G probably damaging Het
Vmn2r75 T A 7: 85,797,644 (GRCm39) D723V probably damaging Het
Wnt2 C A 6: 18,028,091 (GRCm39) V48L possibly damaging Het
Other mutations in Ctsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64,515,982 (GRCm39) missense probably damaging 1.00
IGL02895:Ctsl APN 13 64,514,326 (GRCm39) missense probably damaging 0.97
mauvais UTSW 13 64,511,916 (GRCm39) splice site probably null
patch UTSW 13 64,514,437 (GRCm39) nonsense probably null
G1patch:Ctsl UTSW 13 64,514,437 (GRCm39) nonsense probably null
R0518:Ctsl UTSW 13 64,513,032 (GRCm39) missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64,513,032 (GRCm39) missense possibly damaging 0.75
R1546:Ctsl UTSW 13 64,515,693 (GRCm39) missense probably damaging 1.00
R2096:Ctsl UTSW 13 64,516,840 (GRCm39) critical splice donor site probably null
R5690:Ctsl UTSW 13 64,513,022 (GRCm39) missense probably damaging 1.00
R5804:Ctsl UTSW 13 64,514,302 (GRCm39) missense probably damaging 1.00
R6182:Ctsl UTSW 13 64,515,786 (GRCm39) missense probably damaging 0.99
R6725:Ctsl UTSW 13 64,514,437 (GRCm39) nonsense probably null
R6886:Ctsl UTSW 13 64,512,961 (GRCm39) splice site probably null
R7502:Ctsl UTSW 13 64,514,882 (GRCm39) missense probably damaging 1.00
R8828:Ctsl UTSW 13 64,514,314 (GRCm39) missense probably damaging 1.00
R8947:Ctsl UTSW 13 64,514,840 (GRCm39) missense probably damaging 1.00
R9354:Ctsl UTSW 13 64,516,850 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAGAATTAAGCACTAAG -3'
(R):5'- TAGAACCCTCAGAGGTAAGTGC -3'

Sequencing Primer
(F):5'- GACTTGGATCCTCAATGATTC -3'
(R):5'- CTCAGAGGTAAGTGCACTCC -3'
Posted On 2018-07-23