Incidental Mutation 'R6670:Mef2c'
ID527111
Institutional Source Beutler Lab
Gene Symbol Mef2c
Ensembl Gene ENSMUSG00000005583
Gene Namemyocyte enhancer factor 2C
Synonyms9930028G15Rik, 5430401D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location83504034-83667080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83662597 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 384 (K384R)
Ref Sequence ENSEMBL: ENSMUSP00000142595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005722] [ENSMUST00000163888] [ENSMUST00000185052] [ENSMUST00000197145] [ENSMUST00000197146] [ENSMUST00000197681] [ENSMUST00000197722] [ENSMUST00000198199] [ENSMUST00000198217] [ENSMUST00000199019] [ENSMUST00000199105] [ENSMUST00000199210] [ENSMUST00000199432] [ENSMUST00000199450]
Predicted Effect probably damaging
Transcript: ENSMUST00000005722
AA Change: K454R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005722
Gene: ENSMUSG00000005583
AA Change: K454R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 5.3e-27 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163888
AA Change: K474R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132547
Gene: ENSMUSG00000005583
AA Change: K474R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 155 1.4e-17 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185052
AA Change: K462R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138826
Gene: ENSMUSG00000005583
AA Change: K462R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 6e-27 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 418 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197145
SMART Domains Protein: ENSMUSP00000142619
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197146
AA Change: K432R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143227
Gene: ENSMUSG00000005583
AA Change: K432R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197681
AA Change: K432R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143420
Gene: ENSMUSG00000005583
AA Change: K432R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197722
SMART Domains Protein: ENSMUSP00000142456
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 2.8e-12 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198199
AA Change: K422R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143742
Gene: ENSMUSG00000005583
AA Change: K422R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 153 2e-23 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198217
AA Change: K408R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142487
Gene: ENSMUSG00000005583
AA Change: K408R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199019
AA Change: K464R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143401
Gene: ENSMUSG00000005583
AA Change: K464R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199105
AA Change: K464R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143212
Gene: ENSMUSG00000005583
AA Change: K464R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199210
AA Change: K384R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142595
Gene: ENSMUSG00000005583
AA Change: K384R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199432
AA Change: K424R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142714
Gene: ENSMUSG00000005583
AA Change: K424R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 3.1e-12 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199450
AA Change: K456R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143315
Gene: ENSMUSG00000005583
AA Change: K456R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 5.1e-15 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200138
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have cardiovascular abnormalities and die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Mef2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Mef2c APN 13 83625380 missense probably damaging 1.00
IGL01012:Mef2c APN 13 83655595 missense probably damaging 1.00
IGL03131:Mef2c APN 13 83662375 missense probably damaging 1.00
IGL03186:Mef2c APN 13 83652868 missense probably benign 0.03
LCD18:Mef2c UTSW 13 83605823 intron probably benign
R0021:Mef2c UTSW 13 83656240 missense probably damaging 1.00
R0062:Mef2c UTSW 13 83652873 missense possibly damaging 0.65
R0480:Mef2c UTSW 13 83592901 missense probably damaging 1.00
R0755:Mef2c UTSW 13 83656353 critical splice donor site probably null
R1290:Mef2c UTSW 13 83662359 missense probably benign 0.19
R4085:Mef2c UTSW 13 83575702 missense probably damaging 0.98
R4734:Mef2c UTSW 13 83662629 makesense probably null
R5230:Mef2c UTSW 13 83652907 missense possibly damaging 0.89
R5385:Mef2c UTSW 13 83662413 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6258:Mef2c UTSW 13 83652938 missense probably damaging 1.00
R6672:Mef2c UTSW 13 83652856 missense probably damaging 1.00
R6702:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6703:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6881:Mef2c UTSW 13 83592942 missense probably damaging 1.00
R6907:Mef2c UTSW 13 83654611 missense probably benign 0.32
R7503:Mef2c UTSW 13 83662504 missense possibly damaging 0.80
R8168:Mef2c UTSW 13 83656350 missense probably damaging 0.99
Z1177:Mef2c UTSW 13 83625266 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAGCCTCAGCATCAAGTCAG -3'
(R):5'- AGTGCTAAGCGTATCTCAGC -3'

Sequencing Primer
(F):5'- GCATCAAGTCAGAACCTGTTTC -3'
(R):5'- CCCTTCCCCATTAAGGTA -3'
Posted On2018-07-23