Incidental Mutation 'R6670:Oxgr1'
ID 527113
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Name oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms LOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6670 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 120019585-120042435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120022257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 179 (N179K)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
AlphaFold Q6IYF8
Predicted Effect probably damaging
Transcript: ENSMUST00000058213
AA Change: N179K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: N179K

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 1544 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5213:Oxgr1 UTSW 14 120022140 nonsense probably null
R5226:Oxgr1 UTSW 14 120022253 missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7089:Oxgr1 UTSW 14 120022202 missense probably damaging 1.00
R7819:Oxgr1 UTSW 14 120022869 critical splice acceptor site probably null
R9672:Oxgr1 UTSW 14 120022042 missense probably damaging 1.00
R9731:Oxgr1 UTSW 14 120022682 missense probably benign 0.00
R9803:Oxgr1 UTSW 14 120022151 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTAAAGCAGCTGTGGGTCCG -3'
(R):5'- AGATTTCATGTGCAAGTTCATCCG -3'

Sequencing Primer
(F):5'- CGAGGCCCGTGAGTCAG -3'
(R):5'- ATGTGCAAGTTCATCCGCTTCG -3'
Posted On 2018-07-23