Incidental Mutation 'R6670:Tbc1d23'
ID527116
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57214217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 73 (I73N)
Ref Sequence ENSEMBL: ENSMUSP00000153899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000226586] [ENSMUST00000228172]
Predicted Effect probably benign
Transcript: ENSMUST00000023431
AA Change: I73N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: I73N

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000226586
AA Change: I73N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227359
Predicted Effect probably benign
Transcript: ENSMUST00000228172
AA Change: I73N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57181534 missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7886:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R7960:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7969:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R8202:Tbc1d23 UTSW 16 57191554 missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57182975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACAGTAAAACCTGGCTCTTTCTC -3'
(R):5'- GGAAAGTCTGATAAAGGAGCCTTTTG -3'

Sequencing Primer
(F):5'- ACCTGGCTCTTTCTCAAAATTATG -3'
(R):5'- AAAGGAGCCTTTTGTTACATGG -3'
Posted On2018-07-23