Incidental Mutation 'R6670:Sod2'
ID527118
Institutional Source Beutler Lab
Gene Symbol Sod2
Ensembl Gene ENSMUSG00000006818
Gene Namesuperoxide dismutase 2, mitochondrial
SynonymsMnSOD, manganese superoxide dismutase, manganese SOD, Sod-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6670 (G1)
Quality Score166.009
Status Validated
Chromosome17
Chromosomal Location13007839-13018119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13008365 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 69 (Y69N)
Ref Sequence ENSEMBL: ENSMUSP00000007012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007012
AA Change: Y69N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007012
Gene: ENSMUSG00000006818
AA Change: Y69N

DomainStartEndE-ValueType
Pfam:Sod_Fe_N 25 106 1e-34 PFAM
Pfam:Sod_Fe_C 113 216 8.1e-41 PFAM
Meta Mutation Damage Score 0.3203 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mutations affect mitochondrial function. Null homozygotes die early with cardiomyopathy, tissue lipid accumulation, neurodegeneration, motor problems and/or metabolic acidosis depending on strain background. Heterozygotes show mitochondria and apoptosis defects with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Tnf A C 17: 35,201,824 M6R possibly damaging Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Sod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Sod2 APN 17 13013577 missense possibly damaging 0.83
IGL03170:Sod2 APN 17 13008370 missense probably benign
R0735:Sod2 UTSW 17 13010564 missense probably damaging 1.00
R1775:Sod2 UTSW 17 13015032 missense probably damaging 0.96
R1909:Sod2 UTSW 17 13015169 makesense probably null
R4928:Sod2 UTSW 17 13008186 missense probably benign 0.30
R6083:Sod2 UTSW 17 13008031 start gained probably benign
R6548:Sod2 UTSW 17 13008363 missense probably benign 0.01
R7526:Sod2 UTSW 17 13008031 start gained probably benign
Z1088:Sod2 UTSW 17 13013538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAATGTTGTGTCGGGCG -3'
(R):5'- CACAACAGTAAGGTCCGTCAAG -3'

Sequencing Primer
(F):5'- TGTTCCTCTCAGCACGGG -3'
(R):5'- CAGTAAGGTCCGTCAAGTACTTTCG -3'
Posted On2018-07-23