Incidental Mutation 'R6670:Tnf'
ID527119
Institutional Source Beutler Lab
Gene Symbol Tnf
Ensembl Gene ENSMUSG00000024401
Gene Nametumor necrosis factor
Synonymstumor necrosis factor-alpha, Tnfa, TNF-alpha, TNFalpha, Tnfsf1a, TNF alpha, DIF
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013693; MGI: 104798

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6670 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35199381-35202007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 35201824 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 6 (M6R)
Ref Sequence ENSEMBL: ENSMUSP00000126122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025263] [ENSMUST00000025266] [ENSMUST00000167924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025263
AA Change: M6R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401
AA Change: M6R

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025266
SMART Domains Protein: ENSMUSP00000025266
Gene: ENSMUSG00000024402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
TNF 60 202 5.38e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167924
AA Change: M6R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401
AA Change: M6R

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184381
Meta Mutation Damage Score 0.2767 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(20) Spontaneous(2) Chemically induced(1)             

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Abcc2 A G 19: 43,839,411 probably benign Het
Acsm3 T A 7: 119,780,755 probably null Het
AW551984 T C 9: 39,592,996 D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,507,072 probably benign Het
Ccdc12 T G 9: 110,708,527 probably null Het
Ctsl T C 13: 64,364,102 probably null Het
Cul1 T A 6: 47,517,134 D460E probably damaging Het
Dnttip2 T A 3: 122,276,221 S362T probably damaging Het
Fbxw16 T A 9: 109,438,212 D317V probably damaging Het
Fbxw9 T A 8: 85,062,210 N196K possibly damaging Het
Grap A G 11: 61,660,238 D32G probably damaging Het
Hhatl T C 9: 121,789,071 D206G probably damaging Het
Hrnr A T 3: 93,331,885 Q3143H unknown Het
Ighv1-62-1 T C 12: 115,386,909 Y46C probably damaging Het
Krtap16-3 A T 16: 88,962,652 Y58N unknown Het
Mef2c A G 13: 83,662,597 K384R probably damaging Het
Nalcn A G 14: 123,464,672 Y476H possibly damaging Het
Oxgr1 A T 14: 120,022,257 N179K probably damaging Het
Polk G A 13: 96,496,630 Q302* probably null Het
Rab3gap1 T A 1: 127,930,775 S540R probably benign Het
Samd5 A T 10: 9,629,064 probably null Het
Sema6d GTGATAC G 2: 124,654,842 probably benign Het
Slc1a6 C A 10: 78,787,812 A15D probably benign Het
Slc8a1 A G 17: 81,649,454 C52R probably damaging Het
Sod2 T A 17: 13,008,365 Y69N possibly damaging Het
Tank T C 2: 61,644,424 probably null Het
Tbc1d23 A T 16: 57,214,217 I73N probably benign Het
Trmt2a C T 16: 18,250,477 A16V possibly damaging Het
Ttn A G 2: 76,725,711 Y21990H probably damaging Het
Uaca C T 9: 60,872,024 S1231L probably benign Het
Ubr1 A G 2: 120,924,130 probably null Het
Unc13b A G 4: 43,255,562 D3849G probably damaging Het
Vmn2r75 T A 7: 86,148,436 D723V probably damaging Het
Wnt2 C A 6: 18,028,092 V48L possibly damaging Het
Other mutations in Tnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dome UTSW 17 35201674 missense probably damaging 0.99
Panr1 UTSW 17 35200204 missense probably damaging 1.00
R0783:Tnf UTSW 17 35201674 missense probably damaging 0.99
R0815:Tnf UTSW 17 35201144 unclassified probably benign
R0863:Tnf UTSW 17 35201144 unclassified probably benign
R2195:Tnf UTSW 17 35201113 unclassified probably null
R2570:Tnf UTSW 17 35200500 missense probably damaging 0.99
R4660:Tnf UTSW 17 35200180 missense probably benign 0.00
R7319:Tnf UTSW 17 35200371 missense possibly damaging 0.58
R7708:Tnf UTSW 17 35200158 missense possibly damaging 0.63
R8093:Tnf UTSW 17 35201096 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCGAGAATAAGGGTTGCCC -3'
(R):5'- CTCTTCCCCAAGGGCTATAAAGG -3'

Sequencing Primer
(F):5'- GGTTGCCCAGACACTCAC -3'
(R):5'- TATAAAGGCGGCCGTCTGC -3'
Posted On2018-07-23