Incidental Mutation 'R6670:Tnf'
ID 527119
Institutional Source Beutler Lab
Gene Symbol Tnf
Ensembl Gene ENSMUSG00000024401
Gene Name tumor necrosis factor
Synonyms DIF, TNF alpha, TNFalpha, Tnfsf1a, Tnfa, tumor necrosis factor-alpha, TNF-alpha
MMRRC Submission 044790-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6670 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35418357-35420983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 35420800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 6 (M6R)
Ref Sequence ENSEMBL: ENSMUSP00000126122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025263] [ENSMUST00000025266] [ENSMUST00000167924]
AlphaFold P06804
Predicted Effect possibly damaging
Transcript: ENSMUST00000025263
AA Change: M6R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401
AA Change: M6R

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025266
SMART Domains Protein: ENSMUSP00000025266
Gene: ENSMUSG00000024402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
TNF 60 202 5.38e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167924
AA Change: M6R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401
AA Change: M6R

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184381
Meta Mutation Damage Score 0.2767 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(20) Spontaneous(2) Chemically induced(1)             
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,827,850 (GRCm39) 1544 probably benign Het
Acsm3 T A 7: 119,379,978 (GRCm39) probably null Het
AW551984 T C 9: 39,504,292 (GRCm39) D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,418,369 (GRCm39) probably benign Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Ccdc12 T G 9: 110,537,595 (GRCm39) probably null Het
Ctsl T C 13: 64,511,916 (GRCm39) probably null Het
Cul1 T A 6: 47,494,068 (GRCm39) D460E probably damaging Het
Dnttip2 T A 3: 122,069,870 (GRCm39) S362T probably damaging Het
Fbxw16 T A 9: 109,267,280 (GRCm39) D317V probably damaging Het
Fbxw9 T A 8: 85,788,839 (GRCm39) N196K possibly damaging Het
Grap A G 11: 61,551,064 (GRCm39) D32G probably damaging Het
Hhatl T C 9: 121,618,137 (GRCm39) D206G probably damaging Het
Hrnr A T 3: 93,239,192 (GRCm39) Q3143H unknown Het
Ighv1-62-1 T C 12: 115,350,529 (GRCm39) Y46C probably damaging Het
Krtap16-3 A T 16: 88,759,540 (GRCm39) Y58N unknown Het
Mef2c A G 13: 83,810,716 (GRCm39) K384R probably damaging Het
Nalcn A G 14: 123,702,084 (GRCm39) Y476H possibly damaging Het
Oxgr1 A T 14: 120,259,669 (GRCm39) N179K probably damaging Het
Polk G A 13: 96,633,138 (GRCm39) Q302* probably null Het
Rab3gap1 T A 1: 127,858,512 (GRCm39) S540R probably benign Het
Samd5 A T 10: 9,504,808 (GRCm39) probably null Het
Sema6d GTGATAC G 2: 124,496,762 (GRCm39) probably benign Het
Slc1a6 C A 10: 78,623,646 (GRCm39) A15D probably benign Het
Slc8a1 A G 17: 81,956,883 (GRCm39) C52R probably damaging Het
Sod2 T A 17: 13,227,252 (GRCm39) Y69N possibly damaging Het
Tank T C 2: 61,474,768 (GRCm39) probably null Het
Tbc1d23 A T 16: 57,034,580 (GRCm39) I73N probably benign Het
Trmt2a C T 16: 18,068,341 (GRCm39) A16V possibly damaging Het
Ttn A G 2: 76,556,055 (GRCm39) Y21990H probably damaging Het
Uaca C T 9: 60,779,306 (GRCm39) S1231L probably benign Het
Ubr1 A G 2: 120,754,611 (GRCm39) probably null Het
Unc13b A G 4: 43,255,562 (GRCm39) D3849G probably damaging Het
Vmn2r75 T A 7: 85,797,644 (GRCm39) D723V probably damaging Het
Wnt2 C A 6: 18,028,091 (GRCm39) V48L possibly damaging Het
Other mutations in Tnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dome UTSW 17 35,420,650 (GRCm39) missense probably damaging 0.99
Panr1 UTSW 17 35,419,180 (GRCm39) missense probably damaging 1.00
R0783:Tnf UTSW 17 35,420,650 (GRCm39) missense probably damaging 0.99
R0815:Tnf UTSW 17 35,420,120 (GRCm39) unclassified probably benign
R0863:Tnf UTSW 17 35,420,120 (GRCm39) unclassified probably benign
R2195:Tnf UTSW 17 35,420,089 (GRCm39) splice site probably null
R2570:Tnf UTSW 17 35,419,476 (GRCm39) missense probably damaging 0.99
R4660:Tnf UTSW 17 35,419,156 (GRCm39) missense probably benign 0.00
R7319:Tnf UTSW 17 35,419,347 (GRCm39) missense possibly damaging 0.58
R7708:Tnf UTSW 17 35,419,134 (GRCm39) missense possibly damaging 0.63
R8093:Tnf UTSW 17 35,420,072 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCGAGAATAAGGGTTGCCC -3'
(R):5'- CTCTTCCCCAAGGGCTATAAAGG -3'

Sequencing Primer
(F):5'- GGTTGCCCAGACACTCAC -3'
(R):5'- TATAAAGGCGGCCGTCTGC -3'
Posted On 2018-07-23