Incidental Mutation 'R6671:Mertk'
ID527126
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 128752023 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505] [ENSMUST00000014505]
Predicted Effect probably null
Transcript: ENSMUST00000014505
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000014505
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145178
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCCTCCTGTGGTTTATAATTG -3'
(R):5'- AGCTCTCCTTCAGGGATGTG -3'

Sequencing Primer
(F):5'- CCTCCTGTGGTTTATAATTGTGATG -3'
(R):5'- AAGAATTATCCCTGGTTTCATGGCC -3'
Posted On2018-07-23