Incidental Mutation 'R6671:Mfsd1'
ID527127
Institutional Source Beutler Lab
Gene Symbol Mfsd1
Ensembl Gene ENSMUSG00000027775
Gene Namemajor facilitator superfamily domain containing 1
Synonyms1200003O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location67582741-67604237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67585662 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 93 (V93A)
Ref Sequence ENSEMBL: ENSMUSP00000029344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029344
AA Change: V93A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029344
Gene: ENSMUSG00000027775
AA Change: V93A

DomainStartEndE-ValueType
Pfam:MFS_1 45 404 2.3e-31 PFAM
Pfam:MFS_2 175 443 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192776
Meta Mutation Damage Score 0.4424 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Mfsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Mfsd1 APN 3 67587911 splice site probably benign
IGL02186:Mfsd1 APN 3 67596595 missense probably benign 0.00
IGL02209:Mfsd1 APN 3 67598132 splice site probably benign
IGL02293:Mfsd1 APN 3 67598092 missense probably damaging 1.00
IGL03132:Mfsd1 APN 3 67587940 missense possibly damaging 0.53
edelweiss UTSW 3 67596603 nonsense probably null
Schneeweiss UTSW 3 67585662 missense possibly damaging 0.79
white UTSW 3 67589829 critical splice acceptor site probably null
R0948:Mfsd1 UTSW 3 67596734 missense possibly damaging 0.61
R2355:Mfsd1 UTSW 3 67601335 missense probably damaging 1.00
R3407:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3408:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3729:Mfsd1 UTSW 3 67582965 missense probably benign 0.03
R3749:Mfsd1 UTSW 3 67582953 missense probably benign 0.09
R4405:Mfsd1 UTSW 3 67600610 missense probably benign 0.07
R4867:Mfsd1 UTSW 3 67587987 critical splice donor site probably null
R5429:Mfsd1 UTSW 3 67599960 missense probably damaging 1.00
R5456:Mfsd1 UTSW 3 67589833 missense probably benign 0.28
R5892:Mfsd1 UTSW 3 67589829 critical splice acceptor site probably null
R6091:Mfsd1 UTSW 3 67599937 splice site probably null
R6120:Mfsd1 UTSW 3 67594385 nonsense probably null
R6752:Mfsd1 UTSW 3 67596603 nonsense probably null
R6799:Mfsd1 UTSW 3 67599981 missense probably damaging 0.97
R7117:Mfsd1 UTSW 3 67600058 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGTCGTAGCTTCCAGAGTC -3'
(R):5'- AAATCAACTCTTCGTGTCCACC -3'

Sequencing Primer
(F):5'- GTCGTAGCTTCCAGAGTCACAAG -3'
(R):5'- GTGTCCACCATATGTCAATTCACAC -3'
Posted On2018-07-23