Incidental Mutation 'R6671:Zbtb8b'
ID527129
Institutional Source Beutler Lab
Gene Symbol Zbtb8b
Ensembl Gene ENSMUSG00000048485
Gene Namezinc finger and BTB domain containing 8b
SynonymsMGC:38362
MMRRC Submission
Accession Numbers

Genbank: NM_153541; MGI: 2387181

Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129425765-129440853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129427784 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 395 (R395Q)
Ref Sequence ENSEMBL: ENSMUSP00000058157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053042] [ENSMUST00000106046]
Predicted Effect probably damaging
Transcript: ENSMUST00000053042
AA Change: R395Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058157
Gene: ENSMUSG00000048485
AA Change: R395Q

DomainStartEndE-ValueType
BTB 24 122 1.89e-25 SMART
low complexity region 132 149 N/A INTRINSIC
ZnF_C2H2 331 353 1.12e-3 SMART
ZnF_C2H2 359 382 1.95e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106046
AA Change: R428Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101661
Gene: ENSMUSG00000048485
AA Change: R428Q

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
BTB 57 155 1.89e-25 SMART
low complexity region 165 182 N/A INTRINSIC
ZnF_C2H2 364 386 1.12e-3 SMART
ZnF_C2H2 392 415 1.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132556
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Zbtb8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zbtb8b APN 4 129433259 missense probably damaging 0.96
IGL01989:Zbtb8b APN 4 129432388 missense probably damaging 1.00
IGL03332:Zbtb8b APN 4 129428568 missense probably damaging 1.00
N/A:Zbtb8b UTSW 4 129432568 missense probably benign
PIT4131001:Zbtb8b UTSW 4 129427515 makesense probably null
R0391:Zbtb8b UTSW 4 129432670 missense probably damaging 1.00
R2389:Zbtb8b UTSW 4 129433273 missense probably benign 0.25
R2392:Zbtb8b UTSW 4 129433189 missense probably damaging 1.00
R2760:Zbtb8b UTSW 4 129432500 missense probably benign 0.04
R5028:Zbtb8b UTSW 4 129433000 missense probably damaging 1.00
R5572:Zbtb8b UTSW 4 129428541 missense probably damaging 1.00
R6029:Zbtb8b UTSW 4 129428493 missense probably damaging 1.00
R6714:Zbtb8b UTSW 4 129432983 missense probably damaging 1.00
R7039:Zbtb8b UTSW 4 129427685 missense possibly damaging 0.48
R7392:Zbtb8b UTSW 4 129432890 missense probably benign 0.01
R7454:Zbtb8b UTSW 4 129432769 missense possibly damaging 0.75
R7634:Zbtb8b UTSW 4 129432962 missense probably damaging 1.00
R8017:Zbtb8b UTSW 4 129428445 missense probably damaging 1.00
R8444:Zbtb8b UTSW 4 129432631 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGCCAGTCATCTGTGTC -3'
(R):5'- AGCAGACTGTGAGTTTCTTCC -3'

Sequencing Primer
(F):5'- CACTCTTCTCGTGGCTTTCAGATG -3'
(R):5'- GACGTAGAGTAAGCTGTATCCCC -3'
Posted On2018-07-23