Incidental Mutation 'R6671:Dnajb6'
ID527131
Institutional Source Beutler Lab
Gene Symbol Dnajb6
Ensembl Gene ENSMUSG00000029131
Gene NameDnaJ heat shock protein family (Hsp40) member B6
SynonymsmDj4, Mrj
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location29735688-29818134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29748420 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000110488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008733] [ENSMUST00000012734] [ENSMUST00000114839] [ENSMUST00000196528] [ENSMUST00000196785] [ENSMUST00000198694]
Predicted Effect probably damaging
Transcript: ENSMUST00000008733
AA Change: E17G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008733
Gene: ENSMUSG00000029131
AA Change: E17G

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 272 293 N/A INTRINSIC
low complexity region 339 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000012734
AA Change: E17G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000012734
Gene: ENSMUSG00000029131
AA Change: E17G

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 223 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114839
AA Change: E17G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110488
Gene: ENSMUSG00000029131
AA Change: E17G

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151976
Predicted Effect possibly damaging
Transcript: ENSMUST00000196528
AA Change: E17G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142878
Gene: ENSMUSG00000029131
AA Change: E17G

DomainStartEndE-ValueType
DnaJ 2 61 3e-34 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196785
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000198694
AA Change: E17G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142783
Gene: ENSMUSG00000029131
AA Change: E17G

DomainStartEndE-ValueType
DnaJ 2 61 1.4e-23 SMART
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ protein family. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. This family member may also play a role in polyglutamine aggregation in specific neurons. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants died at mid-gestation due to a failure of chorioallantoic fusion at embryonic day 8.5, and thus preventing the formation of a mature placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Dnajb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Dnajb6 APN 5 29752418 missense probably damaging 1.00
IGL02706:Dnajb6 APN 5 29752423 missense probably damaging 1.00
R0211:Dnajb6 UTSW 5 29785079 intron probably benign
R0829:Dnajb6 UTSW 5 29785022 intron probably benign
R0925:Dnajb6 UTSW 5 29752400 missense probably damaging 0.98
R1776:Dnajb6 UTSW 5 29785093 intron probably benign
R2357:Dnajb6 UTSW 5 29753640 missense probably damaging 0.98
R3979:Dnajb6 UTSW 5 29751008 missense possibly damaging 0.88
R4151:Dnajb6 UTSW 5 29756236 missense probably benign
R6243:Dnajb6 UTSW 5 29781133 missense probably benign 0.08
R7206:Dnajb6 UTSW 5 29781337 missense possibly damaging 0.94
R7440:Dnajb6 UTSW 5 29757859 missense possibly damaging 0.85
R7536:Dnajb6 UTSW 5 29757806 missense possibly damaging 0.72
R8334:Dnajb6 UTSW 5 29781240 missense unknown
Z1176:Dnajb6 UTSW 5 29752445 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGTTCTCTCTGGGCCAGTAG -3'
(R):5'- ACTGGTGTCTGCCTATCATG -3'

Sequencing Primer
(F):5'- GGTGCTGAGAAGGAACCGACTC -3'
(R):5'- GAGAACCTGTTGCTCTTACTGAGATC -3'
Posted On2018-07-23