Incidental Mutation 'R6671:Glmn'
ID527133
Institutional Source Beutler Lab
Gene Symbol Glmn
Ensembl Gene ENSMUSG00000029276
Gene Nameglomulin, FKBP associated protein
Synonyms9330160J16Rik, Fap48, Fap68
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107548967-107597888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107549414 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 487 (M487L)
Ref Sequence ENSEMBL: ENSMUSP00000098509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058921] [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546] [ENSMUST00000159902] [ENSMUST00000160160]
Predicted Effect probably benign
Transcript: ENSMUST00000058921
SMART Domains Protein: ENSMUSP00000058373
Gene: ENSMUSG00000089798

DomainStartEndE-ValueType
Pfam:DUF4580 12 173 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078021
AA Change: M551L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276
AA Change: M551L

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
AA Change: M551L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276
AA Change: M551L

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
AA Change: M487L

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276
AA Change: M487L

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137939
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159902
SMART Domains Protein: ENSMUSP00000124574
Gene: ENSMUSG00000089798

DomainStartEndE-ValueType
Pfam:DUF4580 10 177 1.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160160
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163064
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Multiple splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete embryonic lethality during organogenesis associated with growth retardation, delayed neural tube closure, incomplete embryo turning, pericardial effusion, disorganized yolk sac vascular plexus and head mesenchyme hypocellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Glmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Glmn APN 5 107570139 missense possibly damaging 0.79
IGL00925:Glmn APN 5 107557327 missense probably damaging 1.00
IGL01092:Glmn APN 5 107578512 critical splice acceptor site probably null
IGL02503:Glmn APN 5 107562778 missense probably damaging 0.98
IGL02725:Glmn APN 5 107575289 missense possibly damaging 0.95
IGL03116:Glmn APN 5 107551083 missense probably damaging 1.00
mauna_kea UTSW 5 107593880 critical splice acceptor site probably null
pillow UTSW 5 107549075 missense probably benign 0.20
R0078:Glmn UTSW 5 107557970 missense probably benign 0.31
R0115:Glmn UTSW 5 107560934 missense probably benign 0.00
R0481:Glmn UTSW 5 107560934 missense probably benign 0.00
R1895:Glmn UTSW 5 107570244 missense probably benign 0.34
R1954:Glmn UTSW 5 107572377 missense probably damaging 1.00
R2090:Glmn UTSW 5 107561928 missense probably damaging 1.00
R2132:Glmn UTSW 5 107578455 missense probably damaging 0.98
R3962:Glmn UTSW 5 107561045 intron probably benign
R4296:Glmn UTSW 5 107558502 missense possibly damaging 0.52
R4591:Glmn UTSW 5 107561051 critical splice donor site probably null
R4679:Glmn UTSW 5 107561075 missense probably damaging 1.00
R4992:Glmn UTSW 5 107557301 missense probably damaging 1.00
R5140:Glmn UTSW 5 107570200 missense probably damaging 0.99
R5215:Glmn UTSW 5 107561886 missense probably benign 0.03
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6116:Glmn UTSW 5 107557340 missense probably damaging 1.00
R7748:Glmn UTSW 5 107562244 critical splice donor site probably null
R7789:Glmn UTSW 5 107549075 missense probably benign 0.20
R8407:Glmn UTSW 5 107570191 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAGAGCATCATGTTGTCATCAC -3'
(R):5'- ACATGTACTACAGTCTGAGAGC -3'

Sequencing Primer
(F):5'- CTGGTCTAGTGTTAAACAACCCAG -3'
(R):5'- TAGTATGTTCAACACACCCTGGG -3'
Posted On2018-07-23