Incidental Mutation 'R6671:Gm3404'
ID527134
Institutional Source Beutler Lab
Gene Symbol Gm3404
Ensembl Gene ENSMUSG00000079091
Gene Namepredicted gene 3404
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6671 (G1)
Quality Score98.0078
Status Not validated
Chromosome5
Chromosomal Location146525801-146528553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146527677 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 163 (R163S)
Ref Sequence ENSEMBL: ENSMUSP00000106226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110596]
Predicted Effect probably benign
Transcript: ENSMUST00000110596
AA Change: R163S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106226
Gene: ENSMUSG00000079091
AA Change: R163S

DomainStartEndE-ValueType
RasGEFN 66 181 2.8e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Gm3404
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Gm3404 APN 5 146528285 missense probably damaging 0.98
IGL01611:Gm3404 APN 5 146528347 missense possibly damaging 0.46
IGL02721:Gm3404 APN 5 146526928 nonsense probably null
IGL03134:Gm3404 UTSW 5 146526896 missense probably benign
R1758:Gm3404 UTSW 5 146526226 missense probably benign 0.02
R6324:Gm3404 UTSW 5 146528107 missense possibly damaging 0.79
R6641:Gm3404 UTSW 5 146527708 missense probably damaging 0.97
R7042:Gm3404 UTSW 5 146526159 missense probably benign
R8331:Gm3404 UTSW 5 146525949 missense probably damaging 0.97
R8395:Gm3404 UTSW 5 146525914 missense possibly damaging 0.79
Z1177:Gm3404 UTSW 5 146526216 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCACTATACTCATCTGCAGAC -3'
(R):5'- AAAGCTCTGGAGAATACCCTGC -3'

Sequencing Primer
(F):5'- TATACTCATCTGCAGACAGGCTGG -3'
(R):5'- TCTGGAGAATACCCTGCTGGAATC -3'
Posted On2018-07-23