Incidental Mutation 'R6671:Fkbp14'
ID527135
Institutional Source Beutler Lab
Gene Symbol Fkbp14
Ensembl Gene ENSMUSG00000038074
Gene NameFK506 binding protein 14
SynonymsFKBP22
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location54577604-54597308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54579677 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 69 (Y69H)
Ref Sequence ENSEMBL: ENSMUSP00000112526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046520] [ENSMUST00000117375] [ENSMUST00000155047]
Predicted Effect probably damaging
Transcript: ENSMUST00000046520
AA Change: Y163H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046070
Gene: ENSMUSG00000038074
AA Change: Y163H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 38 132 2e-28 PFAM
Pfam:EF-hand_7 116 207 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117375
AA Change: Y69H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074
AA Change: Y69H

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141757
Predicted Effect probably benign
Transcript: ENSMUST00000155047
SMART Domains Protein: ENSMUSP00000114521
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 38 117 7.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Fkbp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02953:Fkbp14 APN 6 54579682 missense probably damaging 1.00
IGL03056:Fkbp14 APN 6 54579544 missense probably benign 0.00
R4178:Fkbp14 UTSW 6 54589314 missense probably damaging 1.00
R4863:Fkbp14 UTSW 6 54585945 splice site probably benign
R4975:Fkbp14 UTSW 6 54592958 missense probably benign 0.01
R5710:Fkbp14 UTSW 6 54589270 splice site probably null
R5714:Fkbp14 UTSW 6 54585850 missense probably damaging 1.00
R6792:Fkbp14 UTSW 6 54585852 nonsense probably null
R7606:Fkbp14 UTSW 6 54593018 missense probably benign 0.01
R7748:Fkbp14 UTSW 6 54595520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAAAATGGCAGGCGCGTCC -3'
(R):5'- CCGCAAATTTAAATGAGCTGTG -3'

Sequencing Primer
(F):5'- CCTACAGTTCGTCGTGCACATATG -3'
(R):5'- CTTACCATGTAAGCTTGGGGACC -3'
Posted On2018-07-23