Incidental Mutation 'R6671:5430401F13Rik'
ID527136
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene NameRIKEN cDNA 5430401F13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location131486400-131553763 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 131551350 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
Predicted Effect probably benign
Transcript: ENSMUST00000075020
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161385
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131552592 missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131552779 missense unknown
R1674:5430401F13Rik UTSW 6 131552803 missense unknown
R6374:5430401F13Rik UTSW 6 131552929 missense unknown
R7150:5430401F13Rik UTSW 6 131552667 missense probably benign 0.16
RF005:5430401F13Rik UTSW 6 131552884 small insertion probably benign
RF014:5430401F13Rik UTSW 6 131552857 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552856 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552859 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552861 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552855 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552878 small insertion probably benign
RF029:5430401F13Rik UTSW 6 131552895 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552888 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552873 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552892 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552894 small insertion probably benign
RF042:5430401F13Rik UTSW 6 131552886 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552901 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552883 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552884 small insertion probably benign
X0062:5430401F13Rik UTSW 6 131552638 missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131552721 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTAGGTTCAATCTATGACAGCAAAC -3'
(R):5'- TGTCACCACAAGGACAACTG -3'

Sequencing Primer
(F):5'- GTTCAATCTATGACAGCAAACAAAAC -3'
(R):5'- GCTGGACTCGAACTCAGAAATCTG -3'
Posted On2018-07-23