Incidental Mutation 'R6671:Tpp1'
ID527137
Institutional Source Beutler Lab
Gene Symbol Tpp1
Ensembl Gene ENSMUSG00000030894
Gene Nametripeptidyl peptidase I
SynonymsCln2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105744811-105752235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105749607 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000033184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
Predicted Effect probably benign
Transcript: ENSMUST00000033184
AA Change: R205H

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: R205H

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.7822 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Tpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Tpp1 APN 7 105749053 missense probably damaging 1.00
IGL01520:Tpp1 APN 7 105747729 missense probably benign 0.32
IGL01796:Tpp1 APN 7 105747650 unclassified probably benign
IGL01797:Tpp1 APN 7 105749252 missense probably benign 0.07
IGL01923:Tpp1 APN 7 105751650 missense probably benign 0.34
IGL02400:Tpp1 APN 7 105747031 missense possibly damaging 0.91
IGL02411:Tpp1 APN 7 105749619 missense probably damaging 1.00
IGL02423:Tpp1 APN 7 105749700 missense probably damaging 1.00
IGL02672:Tpp1 APN 7 105746961 missense probably benign
IGL03180:Tpp1 APN 7 105746649 missense probably benign
R0709:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R0711:Tpp1 UTSW 7 105749419 missense probably damaging 1.00
R1222:Tpp1 UTSW 7 105746741 missense probably benign 0.05
R1673:Tpp1 UTSW 7 105747673 missense probably damaging 0.99
R1799:Tpp1 UTSW 7 105750308 missense probably benign 0.00
R1822:Tpp1 UTSW 7 105749647 missense probably benign
R1984:Tpp1 UTSW 7 105751698 missense probably benign 0.04
R2109:Tpp1 UTSW 7 105749970 missense probably damaging 1.00
R4304:Tpp1 UTSW 7 105750309 missense possibly damaging 0.70
R4618:Tpp1 UTSW 7 105751706 missense probably benign 0.05
R4746:Tpp1 UTSW 7 105748951 missense probably damaging 1.00
R4764:Tpp1 UTSW 7 105749251 missense probably damaging 1.00
R4837:Tpp1 UTSW 7 105746649 missense probably benign
R4855:Tpp1 UTSW 7 105746723 missense probably benign
R5015:Tpp1 UTSW 7 105752025 unclassified probably benign
R5677:Tpp1 UTSW 7 105747536 missense probably damaging 1.00
R5916:Tpp1 UTSW 7 105749380 missense probably damaging 0.97
R6149:Tpp1 UTSW 7 105747727 missense probably benign 0.00
R6291:Tpp1 UTSW 7 105747016 missense probably benign 0.05
R6422:Tpp1 UTSW 7 105746956 missense probably benign 0.01
R6841:Tpp1 UTSW 7 105748964 missense probably damaging 0.96
R6851:Tpp1 UTSW 7 105749712 missense probably damaging 1.00
R7022:Tpp1 UTSW 7 105748922 missense probably damaging 1.00
R7106:Tpp1 UTSW 7 105749911 missense possibly damaging 0.67
R7260:Tpp1 UTSW 7 105747497 missense probably benign 0.00
R7485:Tpp1 UTSW 7 105749544 missense probably damaging 1.00
R8185:Tpp1 UTSW 7 105749223 critical splice donor site probably null
R8204:Tpp1 UTSW 7 105750315 missense probably damaging 0.98
R8513:Tpp1 UTSW 7 105749579 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGCGCATGAACTCAGTCAG -3'
(R):5'- GGCATAGAATCTTTCCAGTAGAGAAG -3'

Sequencing Primer
(F):5'- ACTCAGTCAGATCCGAGTTATGG -3'
(R):5'- CAGTAGAGAAGTGGGTGGTAGTGTC -3'
Posted On2018-07-23