Incidental Mutation 'R6671:Zranb1'
ID527138
Institutional Source Beutler Lab
Gene Symbol Zranb1
Ensembl Gene ENSMUSG00000030967
Gene Namezinc finger, RAN-binding domain containing 1
Synonyms9330160G10Rik, D7Wsu87e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location132931142-132986391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132971313 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000148867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033265] [ENSMUST00000106157] [ENSMUST00000124096] [ENSMUST00000210507] [ENSMUST00000215716]
Predicted Effect probably damaging
Transcript: ENSMUST00000033265
AA Change: D377G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033265
Gene: ENSMUSG00000030967
AA Change: D377G

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 9.8e-35 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106157
AA Change: D377G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101763
Gene: ENSMUSG00000030967
AA Change: D377G

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 1.5e-40 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210507
Predicted Effect probably damaging
Transcript: ENSMUST00000215716
AA Change: D403G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5662 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased CD4+ T cells and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Other mutations in Zranb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zranb1 APN 7 132982504 splice site probably benign
IGL00843:Zranb1 APN 7 132949893 missense probably benign 0.26
IGL01727:Zranb1 APN 7 132966620 missense probably damaging 1.00
IGL02087:Zranb1 APN 7 132973417 splice site probably benign
IGL02676:Zranb1 APN 7 132966681 missense probably benign 0.16
IGL03081:Zranb1 APN 7 132950397 missense probably damaging 0.99
IGL03095:Zranb1 APN 7 132949906 nonsense probably null
IGL03186:Zranb1 APN 7 132950203 missense possibly damaging 0.68
PIT4151001:Zranb1 UTSW 7 132949994 missense probably benign
R0207:Zranb1 UTSW 7 132950385 missense probably damaging 1.00
R0470:Zranb1 UTSW 7 132982771 missense probably damaging 1.00
R0854:Zranb1 UTSW 7 132949848 missense possibly damaging 0.78
R1318:Zranb1 UTSW 7 132966552 nonsense probably null
R1389:Zranb1 UTSW 7 132971333 missense probably damaging 1.00
R1480:Zranb1 UTSW 7 132950016 missense probably benign 0.39
R1656:Zranb1 UTSW 7 132949767 missense probably benign 0.31
R1956:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R1958:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R2010:Zranb1 UTSW 7 132966696 critical splice donor site probably null
R2289:Zranb1 UTSW 7 132950039 missense probably damaging 1.00
R3831:Zranb1 UTSW 7 132982776 missense probably damaging 0.98
R4128:Zranb1 UTSW 7 132966552 nonsense probably null
R4745:Zranb1 UTSW 7 132972714 missense probably damaging 0.97
R5121:Zranb1 UTSW 7 132950187 missense probably benign 0.06
R5262:Zranb1 UTSW 7 132982827 small insertion probably benign
R5263:Zranb1 UTSW 7 132982827 small insertion probably benign
R5264:Zranb1 UTSW 7 132982827 small insertion probably benign
R5522:Zranb1 UTSW 7 132983949 makesense probably null
R6252:Zranb1 UTSW 7 132983904 missense probably benign 0.00
R6519:Zranb1 UTSW 7 132950128 nonsense probably null
R6827:Zranb1 UTSW 7 132949745 missense probably benign 0.17
R6928:Zranb1 UTSW 7 132966594 missense possibly damaging 0.65
R7313:Zranb1 UTSW 7 132982752 missense probably damaging 1.00
R7583:Zranb1 UTSW 7 132983896 missense probably benign 0.00
R8181:Zranb1 UTSW 7 132983779 missense probably damaging 1.00
R8236:Zranb1 UTSW 7 132949664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCCATTGGCAAGGGAATAATACC -3'
(R):5'- CAGAACAGATTGTAAGATCCTAACC -3'

Sequencing Primer
(F):5'- GGGGAAAATTTTGCTTTTAAGTGC -3'
(R):5'- TGCTTTTCCAGAGGACCCAG -3'
Posted On2018-07-23