Incidental Mutation 'R6671:Abce1'
ID527139
Institutional Source Beutler Lab
Gene Symbol Abce1
Ensembl Gene ENSMUSG00000058355
Gene NameATP-binding cassette, sub-family E (OABP), member 1
SynonymsOabp, Rnaseli, RNS4l (Eye)
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location79683462-79711740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79689177 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 404 (V404A)
Ref Sequence ENSEMBL: ENSMUSP00000079379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080536]
Predicted Effect probably benign
Transcript: ENSMUST00000080536
AA Change: V404A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079379
Gene: ENSMUSG00000058355
AA Change: V404A

DomainStartEndE-ValueType
Pfam:RLI 6 37 6.9e-18 PFAM
Pfam:Fer4 48 71 8e-10 PFAM
AAA 102 293 2.34e-8 SMART
low complexity region 343 358 N/A INTRINSIC
AAA 371 539 2.86e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211509
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Abce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Abce1 APN 8 79693447 missense probably damaging 1.00
IGL01967:Abce1 APN 8 79685991 missense probably damaging 1.00
IGL02715:Abce1 APN 8 79690361 missense probably damaging 0.97
IGL02878:Abce1 APN 8 79703007 missense possibly damaging 0.94
IGL03080:Abce1 APN 8 79703001 splice site probably null
R0256:Abce1 UTSW 8 79685943 critical splice donor site probably null
R1458:Abce1 UTSW 8 79707235 missense possibly damaging 0.60
R1871:Abce1 UTSW 8 79685268 nonsense probably null
R1872:Abce1 UTSW 8 79690251 missense possibly damaging 0.82
R1879:Abce1 UTSW 8 79687456 missense probably benign
R1957:Abce1 UTSW 8 79685949 missense probably benign 0.00
R4642:Abce1 UTSW 8 79689353 missense probably damaging 1.00
R4666:Abce1 UTSW 8 79687486 missense probably damaging 1.00
R5579:Abce1 UTSW 8 79700586 missense possibly damaging 0.94
R5583:Abce1 UTSW 8 79690293 missense probably benign
R5666:Abce1 UTSW 8 79690277 missense probably benign 0.01
R6484:Abce1 UTSW 8 79690323 missense probably damaging 0.98
R7084:Abce1 UTSW 8 79699414 missense probably benign 0.13
R7098:Abce1 UTSW 8 79686049 missense probably benign
R7246:Abce1 UTSW 8 79703069 missense probably damaging 1.00
R7283:Abce1 UTSW 8 79685256 nonsense probably null
R7604:Abce1 UTSW 8 79699374 missense probably benign 0.05
R7729:Abce1 UTSW 8 79687908 missense probably damaging 1.00
R8047:Abce1 UTSW 8 79701188 missense possibly damaging 0.77
R8062:Abce1 UTSW 8 79701144 missense possibly damaging 0.91
R8134:Abce1 UTSW 8 79699353 missense probably benign 0.04
Z1177:Abce1 UTSW 8 79687469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTGTGCTAGAAATGATCTGACAAG -3'
(R):5'- TCAGAATGCTTGCTGGAAGGC -3'

Sequencing Primer
(F):5'- ATGTGGTACTGGACACCCATTAGC -3'
(R):5'- ATGCTTGCTGGAAGGCTTAAACC -3'
Posted On2018-07-23