Incidental Mutation 'R6671:Tmprss13'
ID527143
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Nametransmembrane protease, serine 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45319100-45347581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45343231 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 432 (T432M)
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
Predicted Effect probably damaging
Transcript: ENSMUST00000034597
AA Change: T432M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129
AA Change: T432M

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45336105 missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45339404 missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45333674 missense probably benign
IGL02669:Tmprss13 APN 9 45332526 missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45345003 missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45328558 missense unknown
R0233:Tmprss13 UTSW 9 45337100 splice site probably benign
R0271:Tmprss13 UTSW 9 45333688 splice site probably benign
R0415:Tmprss13 UTSW 9 45337132 splice site probably null
R0742:Tmprss13 UTSW 9 45332467 missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45328647 missense unknown
R1447:Tmprss13 UTSW 9 45328580 missense unknown
R1493:Tmprss13 UTSW 9 45336107 missense probably benign 0.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45338318 missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45332545 missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45345042 missense probably damaging 0.99
R5666:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45345332 missense probably damaging 1.00
R6343:Tmprss13 UTSW 9 45343200 missense possibly damaging 0.66
R6583:Tmprss13 UTSW 9 45345305 missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45336101 nonsense probably null
R7135:Tmprss13 UTSW 9 45338345 missense probably damaging 1.00
R7468:Tmprss13 UTSW 9 45328423 missense unknown
R7617:Tmprss13 UTSW 9 45333560 nonsense probably null
R8062:Tmprss13 UTSW 9 45328688 missense unknown
RF009:Tmprss13 UTSW 9 45328464 small insertion probably benign
RF039:Tmprss13 UTSW 9 45328464 small insertion probably benign
S24628:Tmprss13 UTSW 9 45337132 splice site probably null
Z1177:Tmprss13 UTSW 9 45337090 critical splice donor site probably null
Z1177:Tmprss13 UTSW 9 45343192 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCCACTGATTGCTGAAAGG -3'
(R):5'- CCCAGACTAGCCTTCATCTG -3'

Sequencing Primer
(F):5'- TCATTACAAAGCCTTGGGGGACTC -3'
(R):5'- AGACTAGCCTTCATCTGCATAC -3'
Posted On2018-07-23