Incidental Mutation 'R6671:Gldn'
ID527144
Institutional Source Beutler Lab
Gene Symbol Gldn
Ensembl Gene ENSMUSG00000046167
Gene Namegliomedin
SynonymsCRG-L2, Crlg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54286486-54341786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54338407 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 414 (L414P)
Ref Sequence ENSEMBL: ENSMUSP00000056080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056740]
Predicted Effect probably damaging
Transcript: ENSMUST00000056740
AA Change: L414P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056080
Gene: ENSMUSG00000046167
AA Change: L414P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Collagen 136 195 8.3e-11 PFAM
low complexity region 199 211 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
OLF 299 543 1.97e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele fail to form heminodes without overt neurological abnormalities or alteration in nerve conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Gldn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gldn APN 9 54338464 missense probably damaging 0.99
IGL01778:Gldn APN 9 54334492 splice site probably null
IGL02425:Gldn APN 9 54338721 missense probably damaging 1.00
R2284:Gldn UTSW 9 54286565 nonsense probably null
R2902:Gldn UTSW 9 54335814 missense possibly damaging 0.84
R3055:Gldn UTSW 9 54338523 missense probably damaging 0.96
R3683:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3684:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3733:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3734:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R4668:Gldn UTSW 9 54332018 nonsense probably null
R5228:Gldn UTSW 9 54334719 missense probably damaging 0.98
R5574:Gldn UTSW 9 54312922 missense probably damaging 1.00
R5773:Gldn UTSW 9 54334491 critical splice donor site probably null
R5926:Gldn UTSW 9 54338438 missense possibly damaging 0.68
R5943:Gldn UTSW 9 54338437 missense possibly damaging 0.81
R6331:Gldn UTSW 9 54286878 missense probably benign 0.32
R6821:Gldn UTSW 9 54338770 missense probably benign 0.01
R6897:Gldn UTSW 9 54334874 splice site probably null
R7579:Gldn UTSW 9 54338364 missense probably benign 0.21
R7604:Gldn UTSW 9 54338593 missense probably benign
R7705:Gldn UTSW 9 54338692 missense probably benign 0.00
Z1177:Gldn UTSW 9 54286660 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGAGCACTACAAATCACCAGTG -3'
(R):5'- TGTCTGTGACATAGAGGATCCC -3'

Sequencing Primer
(F):5'- AGTGTCCACCAACATGTGTG -3'
(R):5'- AGGATCCCTCGGGCTATGAAG -3'
Posted On2018-07-23