Incidental Mutation 'R6671:Ikbip'
ID527146
Institutional Source Beutler Lab
Gene Symbol Ikbip
Ensembl Gene ENSMUSG00000019975
Gene NameIKBKB interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location91082940-91102607 bp(+) (GRCm38)
Type of Mutationsplice site (3351 bp from exon)
DNA Base Change (assembly) A to G at 91096607 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020149] [ENSMUST00000020150]
Predicted Effect probably benign
Transcript: ENSMUST00000020149
AA Change: D371G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020149
Gene: ENSMUSG00000019975
AA Change: D371G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
coiled coil region 80 154 N/A INTRINSIC
coiled coil region 175 257 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020150
SMART Domains Protein: ENSMUSP00000020150
Gene: ENSMUSG00000019975

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
coiled coil region 89 109 N/A INTRINSIC
coiled coil region 234 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211056
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Ikbip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Ikbip APN 10 91093257 critical splice donor site probably null
IGL02166:Ikbip APN 10 91095790 missense probably damaging 0.97
IGL02493:Ikbip APN 10 91096594 missense probably damaging 0.99
IGL02591:Ikbip APN 10 91096292 missense probably damaging 1.00
PIT4418001:Ikbip UTSW 10 91096533 missense probably benign 0.02
R1763:Ikbip UTSW 10 91096481 missense probably damaging 1.00
R2031:Ikbip UTSW 10 91096612 missense probably benign
R4436:Ikbip UTSW 10 91101889 missense probably damaging 0.97
R4981:Ikbip UTSW 10 91095986 missense probably benign
R6658:Ikbip UTSW 10 91096319 missense probably benign 0.00
R7109:Ikbip UTSW 10 91083228 missense probably benign 0.00
R7595:Ikbip UTSW 10 91096585 missense probably benign
R7596:Ikbip UTSW 10 91083029 unclassified probably benign
R7840:Ikbip UTSW 10 91101755 missense possibly damaging 0.90
R8278:Ikbip UTSW 10 91096328 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGGAGATGCAGAAAACCC -3'
(R):5'- GTTACCAACTGGCTGCAAGAG -3'

Sequencing Primer
(F):5'- ATGCAGAAAACCCTGGAGG -3'
(R):5'- GGAGTGAATGATTCCCAC -3'
Posted On2018-07-23