Incidental Mutation 'R6671:Vps53'
ID527147
Institutional Source Beutler Lab
Gene Symbol Vps53
Ensembl Gene ENSMUSG00000017288
Gene NameVPS53 GARP complex subunit
Synonyms2310040I21Rik, 3100002B05Rik, 2010002A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76046226-76179647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76134506 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 171 (Y171H)
Ref Sequence ENSEMBL: ENSMUSP00000130499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056601] [ENSMUST00000094015] [ENSMUST00000108419] [ENSMUST00000163878] [ENSMUST00000166752] [ENSMUST00000167114] [ENSMUST00000169734] [ENSMUST00000170730]
Predicted Effect probably damaging
Transcript: ENSMUST00000056601
AA Change: Y171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061317
Gene: ENSMUSG00000017288
AA Change: Y171H

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 5.9e-11 PFAM
Pfam:Vps53_N 39 453 1.9e-176 PFAM
low complexity region 520 533 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094015
AA Change: Y142H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091554
Gene: ENSMUSG00000017288
AA Change: Y142H

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 96 6.2e-21 PFAM
Pfam:Vps53_N 93 424 1.4e-133 PFAM
low complexity region 491 504 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108419
AA Change: Y171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104057
Gene: ENSMUSG00000017288
AA Change: Y171H

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 224 4e-11 PFAM
Pfam:Vps53_N 39 233 5.2e-87 PFAM
Pfam:Vps53_N 226 276 1.6e-14 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 643 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143459
Predicted Effect unknown
Transcript: ENSMUST00000163878
AA Change: V37A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166084
Predicted Effect unknown
Transcript: ENSMUST00000166436
AA Change: Y99H
SMART Domains Protein: ENSMUSP00000131387
Gene: ENSMUSG00000017288
AA Change: Y99H

DomainStartEndE-ValueType
Pfam:DUF2450 1 155 1.6e-8 PFAM
Pfam:Vps53_N 1 204 6.1e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166752
AA Change: Y171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129159
Gene: ENSMUSG00000017288
AA Change: Y171H

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 8.2e-12 PFAM
Pfam:Vps53_N 39 230 6e-87 PFAM
Pfam:Vps53_N 226 405 1.4e-60 PFAM
low complexity region 472 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167114
SMART Domains Protein: ENSMUSP00000131663
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 101 1.2e-21 PFAM
Pfam:Vps53_N 104 176 3.1e-15 PFAM
low complexity region 243 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably damaging
Transcript: ENSMUST00000169734
AA Change: Y171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130499
Gene: ENSMUSG00000017288
AA Change: Y171H

DomainStartEndE-ValueType
Pfam:DUF2450 5 225 5.1e-12 PFAM
Pfam:Vps53_N 39 329 1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170143
Predicted Effect probably benign
Transcript: ENSMUST00000170730
SMART Domains Protein: ENSMUSP00000127364
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 54 123 3e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E12.5 with trophoblast cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Vps53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Vps53 APN 11 76077035 splice site probably null
IGL01596:Vps53 APN 11 76063037 missense probably damaging 1.00
IGL01655:Vps53 APN 11 76063034 missense probably damaging 0.97
IGL02275:Vps53 APN 11 76047123 missense probably benign 0.03
IGL02321:Vps53 APN 11 76048538 missense possibly damaging 0.60
IGL02581:Vps53 APN 11 76102057 missense probably damaging 0.99
IGL02821:Vps53 APN 11 76136317 splice site probably benign
IGL02958:Vps53 APN 11 76117711 missense probably damaging 1.00
IGL03001:Vps53 APN 11 76138324 missense probably damaging 1.00
PIT4519001:Vps53 UTSW 11 76117173 missense probably damaging 1.00
R0257:Vps53 UTSW 11 76177385 intron probably benign
R0391:Vps53 UTSW 11 76121579 missense probably benign 0.31
R0421:Vps53 UTSW 11 76082670 missense probably damaging 1.00
R0882:Vps53 UTSW 11 76082659 missense probably damaging 1.00
R2509:Vps53 UTSW 11 76066835 missense possibly damaging 0.49
R3622:Vps53 UTSW 11 76117783 missense probably benign 0.00
R5137:Vps53 UTSW 11 76166248 missense probably damaging 1.00
R5338:Vps53 UTSW 11 76081208 missense probably damaging 1.00
R5756:Vps53 UTSW 11 76092330 splice site probably benign
R5786:Vps53 UTSW 11 76063007 missense probably benign 0.08
R5961:Vps53 UTSW 11 76048490 missense probably damaging 1.00
R6059:Vps53 UTSW 11 76066867 missense possibly damaging 0.57
R6273:Vps53 UTSW 11 76102018 missense probably benign 0.16
R6490:Vps53 UTSW 11 76077055 missense probably benign 0.03
R6657:Vps53 UTSW 11 76134427 missense probably damaging 1.00
R6772:Vps53 UTSW 11 76179498 start codon destroyed probably null
R7378:Vps53 UTSW 11 76077074 missense possibly damaging 0.88
R7735:Vps53 UTSW 11 76047136 missense probably damaging 1.00
R8066:Vps53 UTSW 11 76136307 missense probably damaging 1.00
Z1177:Vps53 UTSW 11 76136198 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCATCTGCAGCTGCTTC -3'
(R):5'- GATGTCACCTTGAGAGTTGGAGC -3'

Sequencing Primer
(F):5'- CTGCAGCTGCTTCCTAGAATAAGG -3'
(R):5'- CACCTTGAGAGTTGGAGCTAAATCC -3'
Posted On2018-07-23