Incidental Mutation 'R6671:Ddhd1'
ID 527150
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
MMRRC Submission 044791-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6671 (G1)
Quality Score 143.467
Status Validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CA to C at 45894689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051310
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087320
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111828
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147551
Predicted Effect probably null
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228352
Predicted Effect probably null
Transcript: ENSMUST00000226301
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,528,313 (GRCm39) probably null Het
Abce1 A G 8: 80,415,806 (GRCm39) V404A probably benign Het
Cpd T A 11: 76,686,359 (GRCm39) I990F probably damaging Het
Dnajb6 A G 5: 29,953,418 (GRCm39) E17G probably damaging Het
Fastk T C 5: 24,646,607 (GRCm39) D308G probably damaging Het
Fkbp14 A G 6: 54,556,662 (GRCm39) Y69H probably damaging Het
Gldn T C 9: 54,245,691 (GRCm39) L414P probably damaging Het
Glmn T A 5: 107,697,280 (GRCm39) M487L probably benign Het
Gm3404 C A 5: 146,464,487 (GRCm39) R163S probably benign Het
Gm5591 T G 7: 38,219,523 (GRCm39) D450A possibly damaging Het
Gucy1b1 T C 3: 81,941,715 (GRCm39) T575A probably benign Het
Hydin T A 8: 111,327,950 (GRCm39) V4819D probably damaging Het
Ikbip A G 10: 90,932,469 (GRCm39) probably null Het
Mertk G T 2: 128,593,943 (GRCm39) probably null Het
Mfsd1 T C 3: 67,492,995 (GRCm39) V93A possibly damaging Het
Myh11 A T 16: 14,044,480 (GRCm39) M641K possibly damaging Het
Myo3a A T 2: 22,299,333 (GRCm39) N269Y probably damaging Het
Nisch A T 14: 30,926,420 (GRCm39) probably benign Het
Otof A G 5: 30,576,877 (GRCm39) V125A probably benign Het
Pla2g4a A G 1: 149,763,382 (GRCm39) I93T probably benign Het
Prrc2c A G 1: 162,525,154 (GRCm39) I484T probably damaging Het
Qrich1 T A 9: 108,410,985 (GRCm39) I170N probably benign Het
Rb1 A T 14: 73,434,706 (GRCm39) M904K probably damaging Het
Rgs11 A T 17: 26,427,272 (GRCm39) K399M probably damaging Het
Tmprss13 C T 9: 45,254,529 (GRCm39) T432M probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Vps53 A G 11: 76,025,332 (GRCm39) Y171H probably damaging Het
Zbtb8b C T 4: 129,321,577 (GRCm39) R395Q probably damaging Het
Zfp81 A T 17: 33,554,413 (GRCm39) C134S probably benign Het
Zranb1 A G 7: 132,573,042 (GRCm39) D403G probably damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45,842,566 (GRCm39) missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4541:Ddhd1 UTSW 14 45,860,313 (GRCm39) nonsense probably null
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6218:Ddhd1 UTSW 14 45,851,633 (GRCm39) missense probably damaging 1.00
R6787:Ddhd1 UTSW 14 45,894,976 (GRCm39) missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45,840,138 (GRCm39) missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGGCAGCAGCACTCTACTC -3'
(R):5'- GTGCGCTGGTTCTACAAGGAAG -3'

Sequencing Primer
(F):5'- TCTACTCACCCAGGAGGC -3'
(R):5'- AGACCTGGAAGCCCTTCATCG -3'
Posted On 2018-07-23