Incidental Mutation 'R6671:Rgs11'
ID527153
Institutional Source Beutler Lab
Gene Symbol Rgs11
Ensembl Gene ENSMUSG00000024186
Gene Nameregulator of G-protein signaling 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26202951-26211324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26208298 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 399 (K399M)
Ref Sequence ENSEMBL: ENSMUSP00000113885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000118487] [ENSMUST00000122058]
Predicted Effect probably damaging
Transcript: ENSMUST00000025020
AA Change: K401M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186
AA Change: K401M

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114988
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118487
SMART Domains Protein: ENSMUSP00000113418
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122058
AA Change: K399M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186
AA Change: K399M

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Rgs11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Rgs11 APN 17 26207397 missense probably damaging 1.00
IGL01617:Rgs11 APN 17 26208250 missense probably damaging 1.00
IGL02150:Rgs11 APN 17 26202994 missense probably benign 0.05
IGL02610:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02612:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02617:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02669:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02670:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02674:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02706:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02707:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02741:Rgs11 APN 17 26207631 missense probably benign 0.31
R0147:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0148:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0508:Rgs11 UTSW 17 26207469 splice site probably benign
R0744:Rgs11 UTSW 17 26203318 missense probably damaging 1.00
R1479:Rgs11 UTSW 17 26208283 splice site probably null
R1599:Rgs11 UTSW 17 26208249 missense probably damaging 1.00
R1779:Rgs11 UTSW 17 26210666 missense probably damaging 1.00
R3692:Rgs11 UTSW 17 26204328 unclassified probably benign
R3807:Rgs11 UTSW 17 26203500 missense probably damaging 0.99
R3889:Rgs11 UTSW 17 26207587 missense probably damaging 0.98
R4689:Rgs11 UTSW 17 26204547 critical splice donor site probably null
R4832:Rgs11 UTSW 17 26207568 missense probably benign 0.00
R5052:Rgs11 UTSW 17 26207973 intron probably benign
R5330:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5331:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5683:Rgs11 UTSW 17 26205181 missense probably benign 0.32
R5879:Rgs11 UTSW 17 26203463 unclassified probably benign
R6156:Rgs11 UTSW 17 26210465 nonsense probably null
R7432:Rgs11 UTSW 17 26207760 missense probably damaging 0.99
R7609:Rgs11 UTSW 17 26207441 missense probably damaging 1.00
R7795:Rgs11 UTSW 17 26207578 missense possibly damaging 0.88
R7820:Rgs11 UTSW 17 26205195 splice site probably null
R8025:Rgs11 UTSW 17 26204385 critical splice donor site probably null
Z1088:Rgs11 UTSW 17 26205772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAAGCTAGTTGGCCATCAC -3'
(R):5'- TGGGGTCTGAATACCACCAC -3'

Sequencing Primer
(F):5'- AAGCTAGTTGGCCATCACTTAGGC -3'
(R):5'- CCACACTGGTTTACTGGTACC -3'
Posted On2018-07-23