Incidental Mutation 'R6671:Zfp81'
ID527154
Institutional Source Beutler Lab
Gene Symbol Zfp81
Ensembl Gene ENSMUSG00000003929
Gene Namezinc finger protein 81
SynonymsKRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R6671 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33329342-33358878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33335439 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 134 (C134S)
Ref Sequence ENSEMBL: ENSMUSP00000050728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054072]
Predicted Effect probably benign
Transcript: ENSMUST00000054072
AA Change: C134S

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050728
Gene: ENSMUSG00000003929
AA Change: C134S

DomainStartEndE-ValueType
KRAB 4 55 1.15e-14 SMART
ZnF_C2H2 222 244 1.04e-3 SMART
ZnF_C2H2 250 272 1.53e-1 SMART
ZnF_C2H2 278 300 1.33e-1 SMART
ZnF_C2H2 306 328 5.21e-4 SMART
ZnF_C2H2 334 356 2.2e-2 SMART
ZnF_C2H2 362 384 1.58e-3 SMART
ZnF_C2H2 390 412 1.64e-1 SMART
ZnF_C2H2 418 440 7.67e-2 SMART
ZnF_C2H2 446 468 1.89e-1 SMART
ZnF_C2H2 474 496 2.86e-1 SMART
ZnF_C2H2 502 524 1.08e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gm5591 T G 7: 38,520,099 D450A possibly damaging Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Zfp81
AlleleSourceChrCoordTypePredicted EffectPPH Score
feuer UTSW 17 33334333 nonsense probably null
R0143:Zfp81 UTSW 17 33335121 missense possibly damaging 0.85
R0220:Zfp81 UTSW 17 33336724 missense possibly damaging 0.93
R0520:Zfp81 UTSW 17 33334377 missense probably damaging 0.97
R0611:Zfp81 UTSW 17 33334619 missense probably benign 0.02
R1171:Zfp81 UTSW 17 33335280 missense probably benign
R1613:Zfp81 UTSW 17 33334783 missense probably damaging 0.98
R1779:Zfp81 UTSW 17 33335106 missense probably benign 0.06
R1970:Zfp81 UTSW 17 33335501 missense probably benign
R2063:Zfp81 UTSW 17 33335304 missense probably benign 0.03
R2314:Zfp81 UTSW 17 33334623 missense probably damaging 0.99
R2898:Zfp81 UTSW 17 33334300 nonsense probably null
R3115:Zfp81 UTSW 17 33334563 missense possibly damaging 0.80
R4207:Zfp81 UTSW 17 33334916 missense probably damaging 1.00
R4497:Zfp81 UTSW 17 33334703 missense possibly damaging 0.47
R4498:Zfp81 UTSW 17 33334703 missense possibly damaging 0.47
R5756:Zfp81 UTSW 17 33334333 nonsense probably null
R5964:Zfp81 UTSW 17 33336845 missense probably damaging 0.99
R7728:Zfp81 UTSW 17 33336817 missense possibly damaging 0.95
Z1176:Zfp81 UTSW 17 33334829 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACCATAACTACATGTCATGATAGCC -3'
(R):5'- TCAGTATAGAGAAATGCACCAACAG -3'

Sequencing Primer
(F):5'- GTCATGATAGCCGTTTCAAATTGC -3'
(R):5'- CCAACAGATTCAAGAGCATATCG -3'
Posted On2018-07-23