Incidental Mutation 'R6672:Ppp1r3d'
ID527159
Institutional Source Beutler Lab
Gene Symbol Ppp1r3d
Ensembl Gene ENSMUSG00000049999
Gene Nameprotein phosphatase 1, regulatory subunit 3D
SynonymsLOC228966, 2610024M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R6672 (G1)
Quality Score96.0077
Status Validated
Chromosome2
Chromosomal Location178411206-178414472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178413759 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 150 (E150G)
Ref Sequence ENSEMBL: ENSMUSP00000061402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058678] [ENSMUST00000094251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058678
AA Change: E150G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061402
Gene: ENSMUSG00000049999
AA Change: E150G

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:CBM_21 151 258 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094251
SMART Domains Protein: ENSMUSP00000091805
Gene: ENSMUSG00000070476

DomainStartEndE-ValueType
Pfam:FAM217 103 331 2.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129003
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of serine and threonine residues in proteins is a crucial step in the regulation of many cellular functions ranging from hormonal regulation to cell division and even short-term memory. The level of phosphorylation is controlled by the opposing actions of protein kinases and protein phosphatases. Protein phosphatase 1 (PP1) is 1 of 4 major serine/threonine-specific protein phosphatases which have been identified in eukaryotic cells. PP1 associates with various regulatory subunits that dictate its subcellular localization and modulate its substrate specificity. Several subunits that target PP1 to glycogen have been identified. This gene encodes a glycogen-targeting subunit of PP1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Ppp1r3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01997:Ppp1r3d APN 2 178413654 missense possibly damaging 0.67
R4391:Ppp1r3d UTSW 2 178414087 missense probably damaging 0.99
R7634:Ppp1r3d UTSW 2 178413372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCAGTACTCAGCACC -3'
(R):5'- GCAGGTCAAGGTGTTTAACGC -3'

Sequencing Primer
(F):5'- GAAGATGTCCTCGGTACCTTCAG -3'
(R):5'- TGTTTAACGCAGGCGACGATC -3'
Posted On2018-07-23