Incidental Mutation 'R6672:Zbtb46'
ID527160
Institutional Source Beutler Lab
Gene Symbol Zbtb46
Ensembl Gene ENSMUSG00000027583
Gene Namezinc finger and BTB domain containing 46
Synonyms2610019F01Rik, Btbd4, 4933406L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181387762-181459426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181411836 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 361 (L361P)
Ref Sequence ENSEMBL: ENSMUSP00000137014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029106] [ENSMUST00000087409] [ENSMUST00000180222]
Predicted Effect probably benign
Transcript: ENSMUST00000029106
AA Change: L361P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029106
Gene: ENSMUSG00000027583
AA Change: L361P

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087409
AA Change: L361P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084672
Gene: ENSMUSG00000027583
AA Change: L361P

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180222
AA Change: L361P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137014
Gene: ENSMUSG00000027583
AA Change: L361P

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Meta Mutation Damage Score 0.3422 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit repressed altered myeloid potential in dendritic cells. Mice homozygous for a different knock-out allele exhibit partial activation of classical dendritic cells in the steady state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Zbtb46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Zbtb46 APN 2 181424135 missense possibly damaging 0.48
IGL02401:Zbtb46 APN 2 181423452 missense probably benign 0.01
R0127:Zbtb46 UTSW 2 181411815 missense probably benign 0.32
R0279:Zbtb46 UTSW 2 181411774 missense possibly damaging 0.67
R1618:Zbtb46 UTSW 2 181424249 missense possibly damaging 0.92
R1711:Zbtb46 UTSW 2 181411684 missense probably damaging 1.00
R1785:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1786:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1906:Zbtb46 UTSW 2 181423839 missense probably damaging 1.00
R4170:Zbtb46 UTSW 2 181424355 start codon destroyed probably null 0.98
R4782:Zbtb46 UTSW 2 181391136 missense probably benign
R5656:Zbtb46 UTSW 2 181423417 critical splice donor site probably null
R5808:Zbtb46 UTSW 2 181423570 missense probably benign 0.00
R5932:Zbtb46 UTSW 2 181411920 missense probably benign 0.00
R6360:Zbtb46 UTSW 2 181391455 missense probably damaging 1.00
R6467:Zbtb46 UTSW 2 181391269 missense probably damaging 1.00
R6960:Zbtb46 UTSW 2 181423424 missense probably damaging 0.99
R7485:Zbtb46 UTSW 2 181423719 missense probably benign 0.04
R7780:Zbtb46 UTSW 2 181391432 missense probably damaging 1.00
Z1177:Zbtb46 UTSW 2 181424044 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCATCCTCAGTGACTCCAGG -3'
(R):5'- ATGACCTGTGTGTACCTCCC -3'

Sequencing Primer
(F):5'- GCTGAACTGAGGTGCTTAAACC -3'
(R):5'- CTGTTCCTAGATGTAGACCTGACG -3'
Posted On2018-07-23