Incidental Mutation 'R6672:Gnl2'
ID527163
Institutional Source Beutler Lab
Gene Symbol Gnl2
Ensembl Gene ENSMUSG00000028869
Gene Nameguanine nucleotide binding protein-like 2 (nucleolar)
SynonymsNgp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location125016585-125055380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125048393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 397 (V397A)
Ref Sequence ENSEMBL: ENSMUSP00000030684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030684]
Predicted Effect probably damaging
Transcript: ENSMUST00000030684
AA Change: V397A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869
AA Change: V397A

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147550
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Gnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Gnl2 APN 4 125047612 splice site probably null
IGL02536:Gnl2 APN 4 125052608 nonsense probably null
IGL03358:Gnl2 APN 4 125052594 missense probably damaging 1.00
PIT4283001:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R0377:Gnl2 UTSW 4 125046382 splice site probably benign
R0419:Gnl2 UTSW 4 125053527 missense probably benign 0.00
R0975:Gnl2 UTSW 4 125048378 missense probably damaging 0.99
R1529:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R1550:Gnl2 UTSW 4 125044234 missense probably damaging 1.00
R1942:Gnl2 UTSW 4 125030164 missense probably benign 0.01
R2095:Gnl2 UTSW 4 125034318 missense probably damaging 1.00
R2125:Gnl2 UTSW 4 125053485 missense probably benign 0.01
R3712:Gnl2 UTSW 4 125046274 missense probably damaging 0.98
R3781:Gnl2 UTSW 4 125037606 missense probably damaging 0.99
R4656:Gnl2 UTSW 4 125040997 nonsense probably null
R4676:Gnl2 UTSW 4 125053473 missense possibly damaging 0.83
R4710:Gnl2 UTSW 4 125053459 missense probably benign 0.01
R4734:Gnl2 UTSW 4 125041018 missense probably benign
R4916:Gnl2 UTSW 4 125043692 missense probably damaging 1.00
R5106:Gnl2 UTSW 4 125053536 critical splice donor site probably null
R5310:Gnl2 UTSW 4 125052840 missense probably benign 0.00
R5506:Gnl2 UTSW 4 125055365 utr 3 prime probably benign
R5967:Gnl2 UTSW 4 125041030 missense probably benign 0.00
R6184:Gnl2 UTSW 4 125054229 critical splice donor site probably null
R6395:Gnl2 UTSW 4 125046265 missense probably damaging 0.99
R6432:Gnl2 UTSW 4 125052560 missense possibly damaging 0.86
R7657:Gnl2 UTSW 4 125030158 missense probably benign 0.00
R8387:Gnl2 UTSW 4 125055334 makesense probably null
R8408:Gnl2 UTSW 4 125044289 missense probably damaging 0.98
RF003:Gnl2 UTSW 4 125043725 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCTGCCAAACTATCACAG -3'
(R):5'- GGCCACTTTAGTCACTCTGC -3'

Sequencing Primer
(F):5'- AGACACAGCAAAGTCCTAGTC -3'
(R):5'- TCCAGCTGACACAGTTCCC -3'
Posted On2018-07-23